AutismKB 2.0

View de novo Variants from PubMed ID: 25284784


Notes:
*iFish(Wang M, Wei L, PIMD: 27527004) is a supporting vector machine (SVM) based classifier which uses gene and gene family specific attributes.
iFish utilized customized prediction cutoff for each classifier that maximizes the sum of sensitivity andspecificity.

Gene ID Gene Symbol Chr Position Effect Ref Alt Coding Change Protein Change Validation iFish Probability iFish Prediction
AutG286122C8orf31 8 144126055 Intron TC T PCR amplification and Sanger s
AutG56965PARP6 15 72535063 Intron CTTCAT C PCR amplification and Sanger s
AutG5733PTGER3 1 71439935 Intron C CG PCR amplification and Sanger s
AutG23515MORC3 21 37744772 Frameshift CAG C PCR amplification and Sanger s
AutG8697CDC23 5 137534408 Frameshift CTG C PCR amplification and Sanger s
AutG1857DVL3 3 183887912 Frameshift G GT PCR amplification and Sanger s
AutG10716TBR1 2 162275481 Frameshift A AC PCR amplification and Sanger s
AutG9749PHACTR2 6 144033170 In-frame GCTT G PCR amplification and Sanger s
AutG22898DENND3 8 142200355 Intron G GGT PCR amplification and Sanger s
AutG23438HARS2 5 140076709 Intron CG C PCR amplification and Sanger s
AutG55167MSL2 3 135871025 Frameshift TCAGA T PCR amplification and Sanger s
AutG9184BUB3 10 124923291 Intron GC G PCR amplification and Sanger s
AutG55904MLL5 7 104702706 Frameshift AC A PCR amplification and Sanger s
AutG1106CHD2 15 93524060 Frameshift TAAAG T PCR amplification and Sanger s
AutG29123ANKRD11 16 89350771 Frameshift CTTTG C PCR amplification and Sanger s
AutG22938SNW1 14 78227470 Frameshift_and_SpliceSite TCTTCTTCCG T PCR amplification and Sanger s
AutG135228CD109 6 74440138 In-frame CTCTAATAGT C PCR amplification and Sanger s
AutG22999RIMS1 6 73102488 Frameshift C CA PCR amplification and Sanger s
AutG27345KCNMB4 12 70824293 In-frame CATG C PCR amplification and Sanger s
AutG23469PHF3 6 64413433 Frameshift CCG C PCR amplification and Sanger s
AutG3785KCNQ2 20 62070073 Frameshift_and_SpliceSite CCTGCAATTCATCAGGGTCAGGTCACA C PCR amplification and Sanger s
AutG9969MED13 17 60060310 In-frame AGGAGTCCTT A PCR amplification and Sanger s
AutG400720ZNF772 19 57986982 Intron G GGGCA PCR amplification and Sanger s
AutG25870SUMF2 7 56144465 Intron CT C PCR amplification and Sanger s
AutG9043SPAG9 17 49072429 Frameshift GATCTA G PCR amplification and Sanger s
AutG59269HIVEP3 1 42048715 Frameshift C CG PCR amplification and Sanger s
AutG5562PRKAA1 5 40775591 In-frame C CTGA PCR amplification and Sanger s
AutG23112TNRC6B 22 40661586 Frameshift AAGAG A PCR amplification and Sanger s
AutG5335PLCG1 20 39791805 Intron G GT PCR amplification and Sanger s
AutG1859DYRK1A 21 38845116 Frameshift CAT C PCR amplification and Sanger s
AutG9844ELMO1 7 37355576 Intron C CA PCR amplification and Sanger s
AutG4763NF1 17 29676099 Intron TCTTA T PCR amplification and Sanger s
AutG85464SSH2 17 27982695 Intron GAGA G PCR amplification and Sanger s
AutG10419PRMT5 14 23392075 Intron TG T PCR amplification and Sanger s
AutG644815FAM83G 17 18874685 In-frame C CGGT PCR amplification and Sanger s
AutG8027STAM 10 17738824 Frameshift CT C PCR amplification and Sanger s
AutG11330CTRC 1 15765077 Intron TG T PCR amplification and Sanger s
AutG5894RAF1 3 12628988 Intron GATATCCCCTGGCACC G PCR amplification and Sanger s
AutG1995ELAVL3 19 11576905 Intron GGGGC G PCR amplification and Sanger s
AutG374378GALNTL4 11 11314679 In-frame TCATCCACG&TG T&T PCR amplification and Sanger s
AutG1953MEGF6 1 3519049 Frameshift AC A PCR amplification and Sanger s
AutG155185AMZ1 7 2748240 In-frame TGAA T PCR amplification and Sanger s

Simple Query:


  (e.g. CHD8)

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics

  • Studies: 1,036
  • Genes: 1,379
  • CNVs/SVs: 5,420
  • SNVs/Indels: 11,669
  • de novo Mutations: 5,669
  • Mosaics: 789
  • Linkage Regions: 172
  • Paper Collected: 6/30/2018
  • Last Update: 8/26/2018


Copyright © 2017, Center for Bioinformatics , Peking University | All Rights Reserved