Variant Details for ZC3H18
Basic Information Top
| Gene Symbol: | ZC3H18 ( FLJ22664,FLJ34530,FLJ36075,NHN1 ) |
|---|---|
| Gene Full Name: | zinc finger CCCH-type containing 18 |
| Band: | 16q24.2 |
| Quick Links | Entrez ID:124245; OMIM: NA; Uniprot ID:ZCH18_HUMAN; ENSEMBL ID: ENSG00000158545; HGNC ID: 25091 |
| Relate to Another Database: | SFARIGene; denovo-db |
Variant Statistic TopClick the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default. Chromosome coordinates: hg19
| Genetic Category | CNVs/SVs | de novo Mutations | Mosaics SNVs | NGS Other Mutations | Low-Scale Gene Mutations | Linkage Regions | Total |
|---|---|---|---|---|---|---|---|
| Number | 3 | 1 | 0 | 0 | 0 | 0 | 4 |
CNVs/SVs Top| CNV ID | Chr | Band | Start | End | Size | Gain/Loss | UCSC Browser | Reference |
|---|---|---|---|---|---|---|---|---|
| AutCNV0000695 | 16 | 16q24.3 | 88672499 | 90294753 | 1622254 | gain | external link | Berkel, 2010 |
| AutCNV0000685 | 16 | 16q24.2-24.3 | 88232499 | 89362499 | 1130000 | loss | external link | Willemsen, 2010 |
| AutCNV0000684 | 16 | 16q24.2-24.3 | 87502499 | 89602499 | 2100000 | loss | external link | Willemsen, 2010 |
NGS de novo Mutations TopiFish (integrated Functional inference of SNVs in human) is based on gene/gene family customized models to classify missense mutations.
| Chr | Pos | Ref | Alt | Coding | AA | Validated Method | iFish Prediction | iFish Probability | Reference |
|---|---|---|---|---|---|---|---|---|---|
| 16 | 88691091 | C | CAAGCCAGGAGACCCTCGGG | -661KPGDPR? | Sanger | Krumm N, 2015 |
NGS Mosaic Mutations Top| Chr | Position | Ref | Alt | Genotype | Validated Method | Reference |
|---|---|---|---|---|---|---|
| No related data! | ||||||
NGS Other Mutations Top| Chr | Pos | Ref | Alt | Coding | AA | Validated | iFish Prediction | iFish Probability | Reference |
|---|---|---|---|---|---|---|---|---|---|
| No related data! | |||||||||
Low-Scale Gene Mutations Top| Chr | Pos | Ref | Alt | Coding | AA | Validated | iFish Prediction | iFish Probability | Reference |
|---|---|---|---|---|---|---|---|---|---|
| No related data! | |||||||||
Linkage Regions Top| Linkage Name | Band | Chr | Marker | LOD | NPL | P Value | Reference |
|---|---|---|---|---|---|---|---|
| No related data! | |||||||