AutismKB 2.0

Variant Details for CAMSAP1


View Evidences View Variants View Annotations
Basic Information Top
Gene Symbol:CAMSAP1 ( DKFZp434F195,DKFZp434G2311,FLJ31228,MGC163452,PRO2405,bA100C15.1 )
Gene Full Name: calmodulin regulated spectrin-associated protein 1
Band: 9q34.3
Quick LinksEntrez ID:157922; OMIM: NA; Uniprot ID:CAMP1_HUMAN; ENSEMBL ID: ENSG00000130559; HGNC ID: 19946
Relate to Another Database: SFARIGene; denovo-db
Variant Statistic Top

Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default. Chromosome coordinates: hg19
Genetic Category CNVs/SVs de novo Mutations Mosaics SNVs NGS Other Mutations Low-Scale Gene Mutations Linkage Regions Total
Number 2 2 1 0 0 3 8
CNVs/SVs Top
CNV ID Chr Band Start End Size Gain/Loss UCSC Browser Reference
AutCNV0000550 9 9q34.13-34.3 134558770 141153431 6594661 loss external link Gregory, 2009
AutCNV0002740 9 9q34.3 138542900 138700518 157618 loss external link Pinto, 2010
NGS de novo Mutations Top
iFish (integrated Functional inference of SNVs in human) is based on gene/gene family customized models to classify missense mutations.
Chr Pos Ref Alt Coding AA Validated Method iFish Prediction iFish Probability Reference
9 138758402 C T strong Iossifov I, 2014
9 138713880 G GATGCCAGGAGGCTGGCGGGATCC Y Turner T, 2017
NGS Mosaic Mutations Top
Chr Position Ref Alt Genotype Validated Method Reference
9 138713882 T C Low-confidence mosaics Resequencing Lim ET, 2017
NGS Other Mutations Top
Chr Pos Ref Alt Coding AA Validated iFish Prediction iFish Probability Reference
No related data!
Low-Scale Gene Mutations Top
Chr Pos Ref Alt Coding AA Validated iFish Prediction iFish Probability Reference
No related data!
Linkage Regions Top
Linkage Name Band Chr Marker LOD NPL P Value Reference
AutLD0000075 9q34.3 9 D9S158 1.66 - - Buxbaum, 2001
AutLD0000033 9q34.3 9 D9S1826 1.46 - - Monaco, 2001
AutLD0000079 9q34.3 9 D9S158/D9S905 1.67 - - Lamb, 2005




Simple Query:


  (e.g. CHD8)

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics

  • Studies: 1,036
  • Genes: 1,379
  • CNVs/SVs: 5,420
  • SNVs/Indels: 11,669
  • de novo Mutations: 5,669
  • Mosaics: 789
  • Linkage Regions: 172
  • Paper Collected: 6/30/2018
  • Last Update: 8/26/2018