Variant Details for CAMSAP1
Basic Information Top
| Gene Symbol: | CAMSAP1 ( DKFZp434F195,DKFZp434G2311,FLJ31228,MGC163452,PRO2405,bA100C15.1 ) |
|---|---|
| Gene Full Name: | calmodulin regulated spectrin-associated protein 1 |
| Band: | 9q34.3 |
| Quick Links | Entrez ID:157922; OMIM: NA; Uniprot ID:CAMP1_HUMAN; ENSEMBL ID: ENSG00000130559; HGNC ID: 19946 |
| Relate to Another Database: | SFARIGene; denovo-db |
Variant Statistic Top
Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default. Chromosome coordinates: hg19
| Genetic Category | CNVs/SVs | de novo Mutations | Mosaics SNVs | NGS Other Mutations | Low-Scale Gene Mutations | Linkage Regions | Total |
|---|---|---|---|---|---|---|---|
| Number | 2 | 2 | 1 | 0 | 0 | 3 | 8 |
CNVs/SVs Top
| CNV ID | Chr | Band | Start | End | Size | Gain/Loss | UCSC Browser | Reference |
|---|---|---|---|---|---|---|---|---|
| AutCNV0000550 | 9 | 9q34.13-34.3 | 134558770 | 141153431 | 6594661 | loss | external link | Gregory, 2009 |
| AutCNV0002740 | 9 | 9q34.3 | 138542900 | 138700518 | 157618 | loss | external link | Pinto, 2010 |
NGS de novo Mutations Top
iFish (integrated Functional inference of SNVs in human) is based on gene/gene family customized models to classify missense mutations.
| Chr | Pos | Ref | Alt | Coding | AA | Validated Method | iFish Prediction | iFish Probability | Reference |
|---|---|---|---|---|---|---|---|---|---|
| 9 | 138758402 | C | T | strong | Iossifov I, 2014 | ||||
| 9 | 138713880 | G | GATGCCAGGAGGCTGGCGGGATCC | Y | Turner T, 2017 |
NGS Mosaic Mutations Top
| Chr | Position | Ref | Alt | Genotype | Validated Method | Reference |
|---|---|---|---|---|---|---|
| 9 | 138713882 | T | C | Low-confidence mosaics | Resequencing | Lim ET, 2017 |
NGS Other Mutations Top
| Chr | Pos | Ref | Alt | Coding | AA | Validated | iFish Prediction | iFish Probability | Reference |
|---|---|---|---|---|---|---|---|---|---|
| No related data! | |||||||||
Low-Scale Gene Mutations Top
| Chr | Pos | Ref | Alt | Coding | AA | Validated | iFish Prediction | iFish Probability | Reference |
|---|---|---|---|---|---|---|---|---|---|
| No related data! | |||||||||
Linkage Regions Top
| Linkage Name | Band | Chr | Marker | LOD | NPL | P Value | Reference |
|---|---|---|---|---|---|---|---|
| AutLD0000075 | 9q34.3 | 9 | D9S158 | 1.66 | - | - | Buxbaum, 2001 |
| AutLD0000033 | 9q34.3 | 9 | D9S1826 | 1.46 | - | - | Monaco, 2001 |
| AutLD0000079 | 9q34.3 | 9 | D9S158/D9S905 | 1.67 | - | - | Lamb, 2005 |

