Variant Details for CAMSAP1


Gene Symbol: | CAMSAP1 ( DKFZp434F195,DKFZp434G2311,FLJ31228,MGC163452,PRO2405,bA100C15.1 ) |
---|---|
Gene Full Name: | calmodulin regulated spectrin-associated protein 1 |
Band: | 9q34.3 |
Quick Links | Entrez ID:157922; OMIM: NA; Uniprot ID:CAMP1_HUMAN; ENSEMBL ID: ENSG00000130559; HGNC ID: 19946 |
Relate to Another Database: | SFARIGene; denovo-db |


Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default. Chromosome coordinates: hg19
Genetic Category | CNVs/SVs | de novo Mutations | Mosaics SNVs | NGS Other Mutations | Low-Scale Gene Mutations | Linkage Regions | Total |
---|---|---|---|---|---|---|---|
Number | 2 | 2 | 1 | 0 | 0 | 3 | 8 |


CNV ID | Chr | Band | Start | End | Size | Gain/Loss | UCSC Browser | Reference |
---|---|---|---|---|---|---|---|---|
AutCNV0000550 | 9 | 9q34.13-34.3 | 134558770 | 141153431 | 6594661 | loss | external link | Gregory, 2009 |
AutCNV0002740 | 9 | 9q34.3 | 138542900 | 138700518 | 157618 | loss | external link | Pinto, 2010 |


iFish (integrated Functional inference of SNVs in human) is based on gene/gene family customized models to classify missense mutations.
Chr | Pos | Ref | Alt | Coding | AA | Validated Method | iFish Prediction | iFish Probability | Reference |
---|---|---|---|---|---|---|---|---|---|
9 | 138758402 | C | T | strong | Iossifov I, 2014 | ||||
9 | 138713880 | G | GATGCCAGGAGGCTGGCGGGATCC | Y | Turner T, 2017 |


Chr | Position | Ref | Alt | Genotype | Validated Method | Reference |
---|---|---|---|---|---|---|
9 | 138713882 | T | C | Low-confidence mosaics | Resequencing | Lim ET, 2017 |


Chr | Pos | Ref | Alt | Coding | AA | Validated | iFish Prediction | iFish Probability | Reference |
---|---|---|---|---|---|---|---|---|---|
No related data! |


Chr | Pos | Ref | Alt | Coding | AA | Validated | iFish Prediction | iFish Probability | Reference |
---|---|---|---|---|---|---|---|---|---|
No related data! |


Linkage Name | Band | Chr | Marker | LOD | NPL | P Value | Reference |
---|---|---|---|---|---|---|---|
AutLD0000075 | 9q34.3 | 9 | D9S158 | 1.66 | - | - | Buxbaum, 2001 |
AutLD0000033 | 9q34.3 | 9 | D9S1826 | 1.46 | - | - | Monaco, 2001 |
AutLD0000079 | 9q34.3 | 9 | D9S158/D9S905 | 1.67 | - | - | Lamb, 2005 |