Variant Details for UBE2K
![](img/hide.gif)
![](img/arrow-up.png)
Gene Symbol: | UBE2K ( DKFZp564C1216,DKFZp686J24237,E2-25K,HIP2,HYPG,LIG ) |
---|---|
Gene Full Name: | ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) |
Band: | 4p14 |
Quick Links | Entrez ID:3093; OMIM: 602846; Uniprot ID:UBE2K_HUMAN; ENSEMBL ID: ENSG00000078140; HGNC ID: 4914 |
Relate to Another Database: | SFARIGene; denovo-db |
![](img/hide.gif)
![](img/arrow-up.png)
Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default. Chromosome coordinates: hg19
Genetic Category | CNVs/SVs | de novo Mutations | Mosaics SNVs | NGS Other Mutations | Low-Scale Gene Mutations | Linkage Regions | Total |
---|---|---|---|---|---|---|---|
Number | 1 | 1 | 0 | 0 | 0 | 0 | 2 |
![](img/hide.gif)
![](img/arrow-up.png)
CNV ID | Chr | Band | Start | End | Size | Gain/Loss | UCSC Browser | Reference |
---|---|---|---|---|---|---|---|---|
AutCNV0004427 | 4 | 4p14 | 39726437 | 39937513 | 211076 | gain | external link | Nord, 2011 |
![](img/hide.gif)
![](img/arrow-up.png)
iFish (integrated Functional inference of SNVs in human) is based on gene/gene family customized models to classify missense mutations.
Chr | Pos | Ref | Alt | Coding | AA | Validated Method | iFish Prediction | iFish Probability | Reference |
---|---|---|---|---|---|---|---|---|---|
4 | 39699887 | CGGTGGCGGTGGTCGTAGCGGTGGCGGA | C | PCR or Sanger sequencing | Iossifov I, 2014 |
![](img/show.gif)
![](img/arrow-up.png)
Chr | Position | Ref | Alt | Genotype | Validated Method | Reference |
---|---|---|---|---|---|---|
No related data! |
![](img/show.gif)
![](img/arrow-up.png)
Chr | Pos | Ref | Alt | Coding | AA | Validated | iFish Prediction | iFish Probability | Reference |
---|---|---|---|---|---|---|---|---|---|
No related data! |
![](img/show.gif)
![](img/arrow-up.png)
Chr | Pos | Ref | Alt | Coding | AA | Validated | iFish Prediction | iFish Probability | Reference |
---|---|---|---|---|---|---|---|---|---|
No related data! |
![](img/show.gif)
![](img/arrow-up.png)
Linkage Name | Band | Chr | Marker | LOD | NPL | P Value | Reference |
---|---|---|---|---|---|---|---|
No related data! |