Variant Details for KCNQ2
Basic Information Top
| Gene Symbol: | KCNQ2 ( BFNC,EBN,EBN1,ENB1,HNSPC,KCNA11,KV7.2,KVEBN1 ) |
|---|---|
| Gene Full Name: | potassium voltage-gated channel, KQT-like subfamily, member 2 |
| Band: | 20q13.33 |
| Quick Links | Entrez ID:3785; OMIM: 602235; Uniprot ID:KCNQ2_HUMAN; ENSEMBL ID: ENSG00000075043; HGNC ID: 6296 |
| Relate to Another Database: | SFARIGene; denovo-db |
Variant Statistic Top
Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default. Chromosome coordinates: hg19
| Genetic Category | CNVs/SVs | de novo Mutations | Mosaics SNVs | NGS Other Mutations | Low-Scale Gene Mutations | Linkage Regions | Total |
|---|---|---|---|---|---|---|---|
| Number | 4 | 2 | 0 | 0 | 0 | 0 | 6 |
CNVs/SVs Top
| CNV ID | Chr | Band | Start | End | Size | Gain/Loss | UCSC Browser | Reference |
|---|---|---|---|---|---|---|---|---|
| AutCNV0000155 | 20 | 20q13.33 | 61478894 | 62906556 | 1427662 | gain | external link | Marshall, 2008 |
| AutCNV0000696 | 20 | 20q13.33 | 58466605 | 62965520 | 4498915 | loss | external link | Berkel, 2010 |
| AutCNV0004382 | 20 | 20q13.33 | 61478894 | 62906556 | 1427662 | gain | external link | Sanders, 2011 |
| AutCNV0005743 | 20 | gain | C Yuen RK, 2017 |
NGS de novo Mutations Top
iFish (integrated Functional inference of SNVs in human) is based on gene/gene family customized models to classify missense mutations.
| Chr | Pos | Ref | Alt | Coding | AA | Validated Method | iFish Prediction | iFish Probability | Reference |
|---|---|---|---|---|---|---|---|---|---|
| 20 | 62070073 | CCTGCAATTCATCAGGGTCAGGTCACA | C | PCR amplification and Sanger s | Dong S, 2014 | ||||
| 20 | 62038127 | C | CT | HiSeq X and Sanger | C Yuen RK, 2017 |
NGS Mosaic Mutations Top
| Chr | Position | Ref | Alt | Genotype | Validated Method | Reference |
|---|---|---|---|---|---|---|
| No related data! | ||||||
NGS Other Mutations Top
| Chr | Pos | Ref | Alt | Coding | AA | Validated | iFish Prediction | iFish Probability | Reference |
|---|---|---|---|---|---|---|---|---|---|
| No related data! | |||||||||
Low-Scale Gene Mutations Top
| Chr | Pos | Ref | Alt | Coding | AA | Validated | iFish Prediction | iFish Probability | Reference |
|---|---|---|---|---|---|---|---|---|---|
| No related data! | |||||||||
Linkage Regions Top
| Linkage Name | Band | Chr | Marker | LOD | NPL | P Value | Reference |
|---|---|---|---|---|---|---|---|
| No related data! | |||||||

