AutismKB 2.0

Variant Details for KCNQ2


View Evidences View Variants View Annotations
Basic Information Top
Gene Symbol:KCNQ2 ( BFNC,EBN,EBN1,ENB1,HNSPC,KCNA11,KV7.2,KVEBN1 )
Gene Full Name: potassium voltage-gated channel, KQT-like subfamily, member 2
Band: 20q13.33
Quick LinksEntrez ID:3785; OMIM: 602235; Uniprot ID:KCNQ2_HUMAN; ENSEMBL ID: ENSG00000075043; HGNC ID: 6296
Relate to Another Database: SFARIGene; denovo-db
Variant Statistic Top

Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default. Chromosome coordinates: hg19
Genetic Category CNVs/SVs de novo Mutations Mosaics SNVs NGS Other Mutations Low-Scale Gene Mutations Linkage Regions Total
Number 4 2 0 0 0 0 6
CNVs/SVs Top
CNV ID Chr Band Start End Size Gain/Loss UCSC Browser Reference
AutCNV0000155 20 20q13.33 61478894 62906556 1427662 gain external link Marshall, 2008
AutCNV0000696 20 20q13.33 58466605 62965520 4498915 loss external link Berkel, 2010
AutCNV0004382 20 20q13.33 61478894 62906556 1427662 gain external link Sanders, 2011
AutCNV0005743 20 gain C Yuen RK, 2017
NGS de novo Mutations Top
iFish (integrated Functional inference of SNVs in human) is based on gene/gene family customized models to classify missense mutations.
Chr Pos Ref Alt Coding AA Validated Method iFish Prediction iFish Probability Reference
20 62070073 CCTGCAATTCATCAGGGTCAGGTCACA C PCR amplification and Sanger s Dong S, 2014
20 62038127 C CT HiSeq X and Sanger C Yuen RK, 2017
NGS Mosaic Mutations Top
Chr Position Ref Alt Genotype Validated Method Reference
No related data!
NGS Other Mutations Top
Chr Pos Ref Alt Coding AA Validated iFish Prediction iFish Probability Reference
No related data!
Low-Scale Gene Mutations Top
Chr Pos Ref Alt Coding AA Validated iFish Prediction iFish Probability Reference
No related data!
Linkage Regions Top
Linkage Name Band Chr Marker LOD NPL P Value Reference
No related data!




Simple Query:


  (e.g. CHD8)

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics

  • Studies: 1,036
  • Genes: 1,379
  • CNVs/SVs: 5,420
  • SNVs/Indels: 11,669
  • de novo Mutations: 5,669
  • Mosaics: 789
  • Linkage Regions: 172
  • Paper Collected: 6/30/2018
  • Last Update: 8/26/2018