Variant Details for SUV420H1
Basic Information Top
Gene Symbol: | SUV420H1 ( CGI85,KMT5B,MGC118906,MGC118909,MGC21161,MGC703 ) |
---|---|
Gene Full Name: | suppressor of variegation 4-20 homolog 1 (Drosophila) |
Band: | 11q13.2 |
Quick Links | Entrez ID:51111; OMIM: 610881; Uniprot ID:SV421_HUMAN; ENSEMBL ID: ENSG00000110066; HGNC ID: |
Relate to Another Database: | SFARIGene; denovo-db |
Variant Statistic Top
Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default. Chromosome coordinates: hg19
Genetic Category | CNVs/SVs | de novo Mutations | Mosaics SNVs | NGS Other Mutations | Low-Scale Gene Mutations | Linkage Regions | Total |
---|---|---|---|---|---|---|---|
Number | 0 | 6 | 0 | 0 | 0 | 0 | 6 |
CNVs/SVs Top
CNV ID | Chr | Band | Start | End | Size | Gain/Loss | UCSC Browser | Reference |
---|---|---|---|---|---|---|---|---|
No related data! |
NGS de novo Mutations Top
iFish (integrated Functional inference of SNVs in human) is based on gene/gene family customized models to classify missense mutations.
Chr | Pos | Ref | Alt | Coding | AA | Validated Method | iFish Prediction | iFish Probability | Reference |
---|---|---|---|---|---|---|---|---|---|
11 | 67939039 | C | G | c.791G>C | p.Trp264Ser | Sanger sequencing | deleterious | 0.7272 | Sanders SJ, 2012 |
11 | 67926275 | G | A | c.1538C>T | p.Ala513Val | Sanger sequencing | neutral | 0.5290 | Sanders SJ, 2012 |
11 | 67925466 | G | A | Sanger sequencing | De Rubeis S, 2014 | ||||
11 | 67941366 | CAAAT | C | Sanger sequencing | De Rubeis S, 2014 | ||||
11 | 67926275 | G | A | molecular inversion probe rese | neutral | 0.5290 | Turner TN, 2016 | ||
11 | 67926063 | AGGAGCTGGCTGCAGCTGTTCACCACTGTCGGGGCAAGGTTCCGTCACACTGCTTTTATAGCCATTCAACGTATTTG | A | HiSeq X and Sanger | C Yuen RK, 2017 |
NGS Mosaic Mutations Top
Chr | Position | Ref | Alt | Genotype | Validated Method | Reference |
---|---|---|---|---|---|---|
No related data! |
NGS Other Mutations Top
Chr | Pos | Ref | Alt | Coding | AA | Validated | iFish Prediction | iFish Probability | Reference |
---|---|---|---|---|---|---|---|---|---|
No related data! |
Low-Scale Gene Mutations Top
Chr | Pos | Ref | Alt | Coding | AA | Validated | iFish Prediction | iFish Probability | Reference |
---|---|---|---|---|---|---|---|---|---|
No related data! |
Linkage Regions Top
Linkage Name | Band | Chr | Marker | LOD | NPL | P Value | Reference |
---|---|---|---|---|---|---|---|
No related data! |