AutismKB 2.0

Variant Details for ANKIB1


View Evidences View Variants View Annotations
Basic Information Top
Gene Symbol:ANKIB1 ( DKFZp434A0225,FLJ33123,KIAA1386 )
Gene Full Name: ankyrin repeat and IBR domain containing 1
Band: 7q21.2
Quick LinksEntrez ID:54467; OMIM: NA; Uniprot ID:AKIB1_HUMAN; ENSEMBL ID: ENSG00000001629; HGNC ID: 22215
Relate to Another Database: SFARIGene; denovo-db
Variant Statistic Top

Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default. Chromosome coordinates: hg19
Genetic Category CNVs/SVs de novo Mutations Mosaics SNVs NGS Other Mutations Low-Scale Gene Mutations Linkage Regions Total
Number 0 1 0 0 0 1 2
CNVs/SVs Top
CNV ID Chr Band Start End Size Gain/Loss UCSC Browser Reference
No related data!
NGS de novo Mutations Top
iFish (integrated Functional inference of SNVs in human) is based on gene/gene family customized models to classify missense mutations.
Chr Pos Ref Alt Coding AA Validated Method iFish Prediction iFish Probability Reference
7 92028037 AACTGGTGCTGCCAGAAGATTC A strong Iossifov I, 2014
NGS Mosaic Mutations Top
Chr Position Ref Alt Genotype Validated Method Reference
No related data!
NGS Other Mutations Top
Chr Pos Ref Alt Coding AA Validated iFish Prediction iFish Probability Reference
No related data!
Low-Scale Gene Mutations Top
Chr Pos Ref Alt Coding AA Validated iFish Prediction iFish Probability Reference
No related data!
Linkage Regions Top
Linkage Name Band Chr Marker LOD NPL P Value Reference
AutLD0000124 7q21.2 7 D7S1813 2.2 - - Barrett, 1999




Simple Query:


  (e.g. CHD8)

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics

  • Studies: 1,036
  • Genes: 1,379
  • CNVs/SVs: 5,420
  • SNVs/Indels: 11,669
  • de novo Mutations: 5,669
  • Mosaics: 789
  • Linkage Regions: 172
  • Paper Collected: 6/30/2018
  • Last Update: 8/26/2018