Variant Details for ANKIB1


Gene Symbol: | ANKIB1 ( DKFZp434A0225,FLJ33123,KIAA1386 ) |
---|---|
Gene Full Name: | ankyrin repeat and IBR domain containing 1 |
Band: | 7q21.2 |
Quick Links | Entrez ID:54467; OMIM: NA; Uniprot ID:AKIB1_HUMAN; ENSEMBL ID: ENSG00000001629; HGNC ID: 22215 |
Relate to Another Database: | SFARIGene; denovo-db |


Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default. Chromosome coordinates: hg19
Genetic Category | CNVs/SVs | de novo Mutations | Mosaics SNVs | NGS Other Mutations | Low-Scale Gene Mutations | Linkage Regions | Total |
---|---|---|---|---|---|---|---|
Number | 0 | 1 | 0 | 0 | 0 | 1 | 2 |


CNV ID | Chr | Band | Start | End | Size | Gain/Loss | UCSC Browser | Reference |
---|---|---|---|---|---|---|---|---|
No related data! |


iFish (integrated Functional inference of SNVs in human) is based on gene/gene family customized models to classify missense mutations.
Chr | Pos | Ref | Alt | Coding | AA | Validated Method | iFish Prediction | iFish Probability | Reference |
---|---|---|---|---|---|---|---|---|---|
7 | 92028037 | AACTGGTGCTGCCAGAAGATTC | A | strong | Iossifov I, 2014 |


Chr | Position | Ref | Alt | Genotype | Validated Method | Reference |
---|---|---|---|---|---|---|
No related data! |


Chr | Pos | Ref | Alt | Coding | AA | Validated | iFish Prediction | iFish Probability | Reference |
---|---|---|---|---|---|---|---|---|---|
No related data! |


Chr | Pos | Ref | Alt | Coding | AA | Validated | iFish Prediction | iFish Probability | Reference |
---|---|---|---|---|---|---|---|---|---|
No related data! |


Linkage Name | Band | Chr | Marker | LOD | NPL | P Value | Reference |
---|---|---|---|---|---|---|---|
AutLD0000124 | 7q21.2 | 7 | D7S1813 | 2.2 | - | - | Barrett, 1999 |