Variant Details for ZKSCAN3
Basic Information Top
| Gene Symbol: | ZKSCAN3 ( FLJ33906,KIAA0426,ZF47,ZFP306,ZNF306,ZNF309,ZSCAN13,Zfp47,dJ874C20.1 ) |
|---|---|
| Gene Full Name: | zinc finger with KRAB and SCAN domains 3 |
| Band: | 6p22.1 |
| Quick Links | Entrez ID:80317; OMIM: 612791; Uniprot ID:ZKSC3_HUMAN; ENSEMBL ID: ENSG00000189298; HGNC ID: 13853 |
| Relate to Another Database: | SFARIGene; denovo-db |
Variant Statistic TopClick the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default. Chromosome coordinates: hg19
| Genetic Category | CNVs/SVs | de novo Mutations | Mosaics SNVs | NGS Other Mutations | Low-Scale Gene Mutations | Linkage Regions | Total |
|---|---|---|---|---|---|---|---|
| Number | 0 | 1 | 0 | 0 | 0 | 1 | 2 |
CNVs/SVs Top| CNV ID | Chr | Band | Start | End | Size | Gain/Loss | UCSC Browser | Reference |
|---|---|---|---|---|---|---|---|---|
| No related data! | ||||||||
NGS de novo Mutations TopiFish (integrated Functional inference of SNVs in human) is based on gene/gene family customized models to classify missense mutations.
| Chr | Pos | Ref | Alt | Coding | AA | Validated Method | iFish Prediction | iFish Probability | Reference |
|---|---|---|---|---|---|---|---|---|---|
| 6 | 28327608 | AGGAGCAGATCCTGGAGCTGCTGGTGCT | A | strong | Iossifov I, 2014 |
NGS Mosaic Mutations Top| Chr | Position | Ref | Alt | Genotype | Validated Method | Reference |
|---|---|---|---|---|---|---|
| No related data! | ||||||
NGS Other Mutations Top| Chr | Pos | Ref | Alt | Coding | AA | Validated | iFish Prediction | iFish Probability | Reference |
|---|---|---|---|---|---|---|---|---|---|
| No related data! | |||||||||
Low-Scale Gene Mutations Top| Chr | Pos | Ref | Alt | Coding | AA | Validated | iFish Prediction | iFish Probability | Reference |
|---|---|---|---|---|---|---|---|---|---|
| No related data! | |||||||||
Linkage Regions Top| Linkage Name | Band | Chr | Marker | LOD | NPL | P Value | Reference |
|---|---|---|---|---|---|---|---|
| AutLD0000150 | 6p22.1 | 6 | MOGc | - | - | 0.012 | Guerini, 2010 |