Variant Details for TAF15
Basic Information Top
| Gene Symbol: | TAF15 ( Npl3,RBP56,TAF2N,TAFII68,hTAFII68 ) |
|---|---|
| Gene Full Name: | TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa |
| Band: | 17q12 |
| Quick Links | Entrez ID:8148; OMIM: 601574; Uniprot ID:RBP56_HUMAN; ENSEMBL ID: ENSG00000172660; HGNC ID: 11547 |
| Relate to Another Database: | SFARIGene; denovo-db |
Variant Statistic TopClick the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default. Chromosome coordinates: hg19
| Genetic Category | CNVs/SVs | de novo Mutations | Mosaics SNVs | NGS Other Mutations | Low-Scale Gene Mutations | Linkage Regions | Total |
|---|---|---|---|---|---|---|---|
| Number | 1 | 1 | 0 | 0 | 0 | 0 | 2 |
CNVs/SVs Top| CNV ID | Chr | Band | Start | End | Size | Gain/Loss | UCSC Browser | Reference |
|---|---|---|---|---|---|---|---|---|
| AutCNV0000625 | 17 | 17q12 | 34145822 | 34770287 | 624465 | gain | external link | Gregory, 2009 |
NGS de novo Mutations TopiFish (integrated Functional inference of SNVs in human) is based on gene/gene family customized models to classify missense mutations.
| Chr | Pos | Ref | Alt | Coding | AA | Validated Method | iFish Prediction | iFish Probability | Reference |
|---|---|---|---|---|---|---|---|---|---|
| 17 | 34171638 | CTATGGTGGAGACAGAAGTGGGGGT | C | strong | Iossifov I, 2014 |
NGS Mosaic Mutations Top| Chr | Position | Ref | Alt | Genotype | Validated Method | Reference |
|---|---|---|---|---|---|---|
| No related data! | ||||||
NGS Other Mutations Top| Chr | Pos | Ref | Alt | Coding | AA | Validated | iFish Prediction | iFish Probability | Reference |
|---|---|---|---|---|---|---|---|---|---|
| No related data! | |||||||||
Low-Scale Gene Mutations Top| Chr | Pos | Ref | Alt | Coding | AA | Validated | iFish Prediction | iFish Probability | Reference |
|---|---|---|---|---|---|---|---|---|---|
| No related data! | |||||||||
Linkage Regions Top| Linkage Name | Band | Chr | Marker | LOD | NPL | P Value | Reference |
|---|---|---|---|---|---|---|---|
| No related data! | |||||||