AutismKB 2.0

Variant Details for PIP4K2B


View Evidences View Variants View Annotations
Basic Information Top
Gene Symbol:PIP4K2B ( PI5P4KB,PIP5K2B,PIP5KIIB,PIP5KIIbeta )
Gene Full Name: phosphatidylinositol-5-phosphate 4-kinase, type II, beta
Band: 17q12
Quick LinksEntrez ID:8396; OMIM: 603261; Uniprot ID:PI42B_HUMAN; ENSEMBL ID: ENSG00000141720; HGNC ID: 8998
Relate to Another Database: SFARIGene; denovo-db
Variant Statistic Top

Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default. Chromosome coordinates: hg19
Genetic Category CNVs/SVs de novo Mutations Mosaics SNVs NGS Other Mutations Low-Scale Gene Mutations Linkage Regions Total
Number 0 2 1 0 0 0 3
CNVs/SVs Top
CNV ID Chr Band Start End Size Gain/Loss UCSC Browser Reference
No related data!
NGS de novo Mutations Top
iFish (integrated Functional inference of SNVs in human) is based on gene/gene family customized models to classify missense mutations.
Chr Pos Ref Alt Coding AA Validated Method iFish Prediction iFish Probability Reference
17 36955630 G C Sanger sequencing De Rubeis S, 2014
17 36927265 CTTTCATGGCTTTTCATGGC CTTTCATGGC HiSeq X and Sanger C Yuen RK, 2017
NGS Mosaic Mutations Top
Chr Position Ref Alt Genotype Validated Method Reference
17 36927464 C T Mosaic Krupp DR, 2017
NGS Other Mutations Top
Chr Pos Ref Alt Coding AA Validated iFish Prediction iFish Probability Reference
No related data!
Low-Scale Gene Mutations Top
Chr Pos Ref Alt Coding AA Validated iFish Prediction iFish Probability Reference
No related data!
Linkage Regions Top
Linkage Name Band Chr Marker LOD NPL P Value Reference
No related data!




Simple Query:


  (e.g. CHD8)

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics

  • Studies: 1,036
  • Genes: 1,379
  • CNVs/SVs: 5,420
  • SNVs/Indels: 11,669
  • de novo Mutations: 5,669
  • Mosaics: 789
  • Linkage Regions: 172
  • Paper Collected: 6/30/2018
  • Last Update: 8/26/2018