Variant Details for PIP4K2B


Gene Symbol: | PIP4K2B ( PI5P4KB,PIP5K2B,PIP5KIIB,PIP5KIIbeta ) |
---|---|
Gene Full Name: | phosphatidylinositol-5-phosphate 4-kinase, type II, beta |
Band: | 17q12 |
Quick Links | Entrez ID:8396; OMIM: 603261; Uniprot ID:PI42B_HUMAN; ENSEMBL ID: ENSG00000141720; HGNC ID: 8998 |
Relate to Another Database: | SFARIGene; denovo-db |


Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default. Chromosome coordinates: hg19
Genetic Category | CNVs/SVs | de novo Mutations | Mosaics SNVs | NGS Other Mutations | Low-Scale Gene Mutations | Linkage Regions | Total |
---|---|---|---|---|---|---|---|
Number | 0 | 2 | 1 | 0 | 0 | 0 | 3 |


CNV ID | Chr | Band | Start | End | Size | Gain/Loss | UCSC Browser | Reference |
---|---|---|---|---|---|---|---|---|
No related data! |


iFish (integrated Functional inference of SNVs in human) is based on gene/gene family customized models to classify missense mutations.
Chr | Pos | Ref | Alt | Coding | AA | Validated Method | iFish Prediction | iFish Probability | Reference |
---|---|---|---|---|---|---|---|---|---|
17 | 36955630 | G | C | Sanger sequencing | De Rubeis S, 2014 | ||||
17 | 36927265 | CTTTCATGGCTTTTCATGGC | CTTTCATGGC | HiSeq X and Sanger | C Yuen RK, 2017 |


Chr | Position | Ref | Alt | Genotype | Validated Method | Reference |
---|---|---|---|---|---|---|
17 | 36927464 | C | T | Mosaic | Krupp DR, 2017 |


Chr | Pos | Ref | Alt | Coding | AA | Validated | iFish Prediction | iFish Probability | Reference |
---|---|---|---|---|---|---|---|---|---|
No related data! |


Chr | Pos | Ref | Alt | Coding | AA | Validated | iFish Prediction | iFish Probability | Reference |
---|---|---|---|---|---|---|---|---|---|
No related data! |


Linkage Name | Band | Chr | Marker | LOD | NPL | P Value | Reference |
---|---|---|---|---|---|---|---|
No related data! |