AutismKB 2.0

Evidence Details for MIR885


View Evidences View Variants View Annotations
Basic Information Top
Gene Symbol:MIR885 ( MIRN885,hsa-mir-885 )
Gene Full Name: microRNA 885
Band: 3p25.3
Quick LinksEntrez ID:100126334; OMIM: NA; Uniprot ID:; ENSEMBL ID: ; HGNC ID: 33659
Relate to Another Database: SFARIGene; denovo-db
Sequences Top
>MIR885|100126334|nucleotide
TCCATTACACTACCCTGCCTCT










Show »

>MIR885|100126334|protein





Show »

Evidence summary Top

Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default.
Evidences Syndromic Gene GWAS CNV Linkage Association Expression NGS de novo NGS Mosaic NGS Other Low-Scale Gene Studies Total
Score (No. of Studies) No 1 (1) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 4 (1)
Syndromic Autism Gene Top
Genome-Wide Association Studies (By Ethnic Group) Top
Family Based Association Studies: 0
Reference Stage Platform #Families Affecteds Result
#Subjects
(% Women)
ADI-R ADOS Diagnosis Age
(range)
IQ
(range)
No Evidence.
Case Control Based Association Studies: 1
Reference Stage Platform ASD Cases Normal Controls Result
#Subjects
(% Women)
ADI-R ADOS Diagnosis Age
(range)
IQ #Subjects
(% Women)
Age
(range)
MIXED/OTHERS
Anney RJL, 2017_3 replication 1369
(-)
ASD -
-
- 137308
(-)
-
-
CNV Studies Top
Linkage Studies Top
Low Scale Association Studies (by Ethnic Group) Top
Large Scale Expression Studies Top
NGS de novo Mutation Studies Top
NGS Mosaic SNV Studies Top
NGS Other Studies Top
Low Scale Gene Studies Top

Contact Us if you are an author of a study regarding this gene and do not find your study in this table or find errors in the representation of your study details.

Simple Query:


  (e.g. CHD8)

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics

  • Studies: 1,036
  • Genes: 1,379
  • CNVs/SVs: 5,420
  • SNVs/Indels: 11,669
  • de novo Mutations: 5,669
  • Mosaics: 789
  • Linkage Regions: 172
  • Paper Collected: 6/30/2018
  • Last Update: 8/26/2018