Evidence Details for CHD2

View Evidences	View Variants	View Annotations

Basic Information Top

Gene Symbol:	CHD2 ( DKFZp547I1315,DKFZp686E01200,DKFZp781D1727,FLJ38614 )
Gene Full Name:	chromodomain helicase DNA binding protein 2
Band:	15q26.1
Quick Links	Entrez ID:1106; OMIM: 602119; Uniprot ID:CHD2_HUMAN; ENSEMBL ID: ENSG00000173575; HGNC ID: 1917
Relate to Another Database:	SFARIGene; denovo-db

Sequences Top

Nucleotide Sequence
Protein Sequence

>CHD2|1106|nucleotide
ATGATGAGAAATAAGGACAAAAGCCAAGAGGAGGACAGTTCGCTACACAGCAATGCATCGAGTCACTCAGCCTCTGAAGAAGCTTCGGGTTCAGACTCAGGCAGT
CAGTCGGAAAGTGAGCAGGGAAGTGATCCAGGAAGTGGACATGGCAGCGAGTCGAACAGCAGCTCTGAATCTTCTGAGAGTCAGTCGGAATCTGAGAGCGAATCA
GCAGGTTCCAAATCCCAGCCAGTCCTCCCAGAAGCCAAAGAGAAGCCAGCCTCTAAGAAGGAACGGATAGCTGATGTGAAGAAGATGTGGGAAGAATATCCTGAT
GTTTATGGGGTCAGGCGGTCAAACCGAAGCAGACAAGAACCATCGCGATTTAATATTAAGGAAGAGGCAAGTAGCGGGTCTGAGAGTGGGAGCCCAAAAAGAAGA
GGCCAGAGGCAGCTGAAAAAACAAGAAAAATGGAAACAGGAACCCTCAGAAGATGAACAGGAACAAGGCACCAGTGCAGAGAGTGAGCCAGAACAAAAAAAAGTA
AAAGCCAGAAGACCTGTCCCCAGAAGAACAGTGCCCAAACCTCGTGTTAAAAAGCAGCCGAAGACTCAGCGTGGAAAGAGAAAAAAGCAAGATTCTTCTGATGAG
GATGATGATGATGACGAAGCTCCCAAAAGGCAGACTCGTCGAAGAGCGGCTAAAAACGTTAGTTACAAAGAAGATGATGACTTTGAGACTGACTCAGATGATCTC
ATTGAAATGACTGGAGAAGGAGTTGATGAACAGCAAGATAATAGTGAAACTATTGAAAAGGTCTTAGATTCAAGACTGGGAAAGAAAGGAGCCACTGGAGCATCT
ACTACTGTATATGCGATTGAAGCTAATGGCGACCCTAGTGGTGACTTTGACACTGAAAAGGATGAAGGTGAAATCCAGTACCTCATCAAGTGGAAGGGTTGGTCT
TACATCCACAGCACATGGGAGAGTGAAGAATCCTTACAGCAACAGAAAGTGAAGGGCCTAAAAAAACTAGAGAACTTCAAGAAAAAAGAGGACGAAATCAAACAA
TGGTTAGGGAAAGTTTCTCCTGAAGATGTAGAATATTTCAATTGCCAACAGGAGCTGGCTTCAGAGTTGAATAAACAGTATCAGATAGTAGAAAGAGTAATAGCT
Show »

Evidence summary Top

Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default.

Evidences	Syndromic Gene	GWAS	CNV	Linkage	Association	Expression	NGS de novo	NGS Mosaic	NGS Other	Low-Scale Gene Studies	Total
Score (No. of Studies)	No	0 (0)	1 (5)	1 (1)	0 (0)	0 (0)	3 (9)	0 (2)	1 (2)	1 (1)	52 (20)

Syndromic Autism Gene Top

Genome-Wide Association Studies(By Ethnic Group) Top

Reference	Stage	Platform	#Families	Affecteds	Result
#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)
No Evidence.

Reference	Stage	Platform	ASD Cases	Normal Controls	Result
#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)
No Evidence.

CNV Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
Bonati, 2005	-	FISH			autism	-	-	-	-	1	-	1
Szatmari, 2007	Europe, North America	SNP microarray			ASD	1491	-	-	-	-	-	0
Pinto, 2010	-	SNP microarray, qPCR			ASD	-	-	-	-	996	1287	2283
Sanders, 2011	Simons Simplex Collection	SNP microarray	-	-	ASD	1127	1127	-	-	-	-	-
Krumm N, 2015	-	-	-	-	-	1266	-	-	-	-	-	-

Linkage Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
Risch, 1999	USA	microsatellite-based genomic screen			PDD	90	-	90	-	-	-	-

Low Scale Association Studies (by Ethnic Group) Top

Reference	Source	Platform	#Families	Affecteds	Result
#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)
No Evidence.

Reference	Source	Platfrom	ASD Cases	Normal Controls	Result
ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)
No Evidence.

Large Scale Expression Studies Top

Reference	Source	Tissue	#Subjects (% Women)	ADI-R	ADOS	Endo- pheno	Diagnosis	Normal Controls (% Women)	Fold Change	Up/ Down	P/Q value
No Evidence.

Reference	Source	Tissue	Platform	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Normal Controls(% Women)
No Evidence.

NGS de novo Mutation Studies Top

Reference	Case Number	Family Number	de novo Number	Title
Neale BM, 2012	175	175	173	Patterns and rates of exonic de novo mutations in autism spectrum disorders.
Dong S, 2014	787	787	42	De novo insertions and deletions of predominantly paternal origin are associated with autism spectru
De Rubeis S, 2014	2270	-	1702	Synaptic, transcriptional and chromatin genes disrupted in autism
O'Roak BJ, 2014	3486	-	59	Recurrent de novo mutations implicate novel genes underlying simplex autism risk.
Wang T, 2016	1543	1045	54	De novo genic mutations among a Chinese autism spectrum disorder cohort
Stessman HA, 2017	6342	-	74	Targeted sequencing identifies 91 neurodevelopmental-disorder risk genes with autism and development
Takata A, 2018	262	262	322	Integrative Analyses of De Novo Mutations Provide Deeper Biological Insights into Autism Spectrum Di
Bowling KM, 2017	18	-	18	Genomic diagnosis for children with intellectual disability and/or developmental delay.

NGS Mosaic SNV Studies Top

Reference	Case Number	Family Number	Mosaic Number	Title
Lim ET, 2017	-	5947	376	Rates, distribution and implications of postzygotic mosaic mutations in autism spectrum disorder
Krupp DR, 2017	-	2264	247	Exonic Mosaic Mutations Contribute Risk for Autism Spectrum Disorder

NGS Other Studies Top

Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Family			Affected	Validation Method
Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Affected	Validation Method
Bi C, 2012	China	GAII			-	-	-	-	67	-
Wang T, 2016	China	Illumina HiSeq 2000			ASD	1045	-	-	1543	PCR and Sanger sequencing

Low Scale Gene Studies Top

Reference	Organism	Tissue	ADI-R	ADOS	Diagnosis	Evidence Level	Result
No Evidence.

Contact Us if you are an author of a study regarding this gene and do not find your study in this table or find errors in the representation of your study details.

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics

Studies: 1,036
Genes: 1,379
CNVs/SVs: 5,420
SNVs/Indels: 11,669
de novo Mutations: 5,669
Mosaics: 789
Linkage Regions: 172

Paper Collected: 6/30/2018

Last Update: 8/26/2018

AutismKB 2.0

Evidence Details for CHD2

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics