AutismKB 2.0

Evidence Details for DUSP15


View Evidences View Variants View Annotations
Basic Information Top
Gene Symbol:DUSP15 ( FLJ40111,VHY )
Gene Full Name: dual specificity phosphatase 15
Band: 20q11.21
Quick LinksEntrez ID:128853; OMIM: NA; Uniprot ID:DUS15_HUMAN; ENSEMBL ID: ENSG00000149599; HGNC ID: 16236
Relate to Another Database: SFARIGene; denovo-db
Sequences Top
>DUSP15|128853|nucleotide
ATGACTGTGACGGGGCTAGGCTGGCGGGACGTGCTTGAAGCCATCAAGGCCACCAGGCCCATCGCCAACCCCAACCCAGGCTTTAGGCAGCAGCTTGAAGAGTTT
GGCTGGGCCAGTTCCCAGAAGCTTCGCCGGCAGCTGGAGGAGCGCTTCGGCGAGAGCCCCTTCCGCGACGAGGAGGAGTTGCGCGCGCTGCTGCCGCTGTGCAAG
CGCTGCCGGCAGGGCTCCGCGACCTCGGCCTCCTCCGCCGGGCCGCACTCAGCAGCCTCCGAGGGAACCGTGCAGCGCCTGGTGCCGCGCACGCCCCGGGAAGCC
CACCGGCCGCTGCCGCTGCTGGCGCGCGTCAAGCAGACTTTCTCTTGCCTCCCCCGGTGTCTGTCCCGCAAGGGCGGCAAGTGA







Show »

>DUSP15|128853|protein
MTVTGLGWRDVLEAIKATRPIANPNPGFRQQLEEFGWASSQKLRRQLEERFGESPFRDEEELRALLPLCKRCRQGSATSASSAGPHSAASEGTVQRLVPRTPREA
HRPLPLLARVKQTFSCLPRCLSRKGGK



Show »

Evidence summary Top

Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default.
Evidences Syndromic Gene GWAS CNV Linkage Association Expression NGS de novo NGS Mosaic NGS Other Low-Scale Gene Studies Total
Score (No. of Studies) No 0 (0) 0 (1) 1 (1) 0 (0) 0 (0) 0 (3) 0 (0) 0 (0) 0 (0) 2 (5)
Syndromic Autism Gene Top
Genome-Wide Association Studies(By Ethnic Group) Top
CNV Studies Top
Reference Source Method ADI-R ADOS Diagnosis Family Individual
Total Simplex Multiplex Control Affected Control Total
Sanders, 2011 Simons Simplex Collection SNP microarray--ASD 1127 1127 - - - - -
Linkage Studies Top
Reference Source Method ADI-R ADOS Diagnosis Family Individual
Total Simplex Multiplex Control Affected Control Total
Allen-Brady, 2008 - SNP-based genomic screenASD 1 - 1 - 7 22 29
Low Scale Association Studies (by Ethnic Group) Top
Large Scale Expression Studies Top
NGS de novo Mutation Studies Top
Reference Case Number Family Number de novo Number Title
Neale BM, 2012 175 175 173 Patterns and rates of exonic de novo mutations in autism spectrum disorders.
De Rubeis S, 2014 2270 - 1702 Synaptic, transcriptional and chromatin genes disrupted in autism
Geisheker MR, 2017 - - 36 Hotspots of missense mutation identify neurodevelopmental disorder genes and functional domains.
NGS Mosaic SNV Studies Top
NGS Other Studies Top
Low Scale Gene Studies Top

Contact Us if you are an author of a study regarding this gene and do not find your study in this table or find errors in the representation of your study details.

Simple Query:


  (e.g. CHD8)

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics

  • Studies: 1,036
  • Genes: 1,379
  • CNVs/SVs: 5,420
  • SNVs/Indels: 11,669
  • de novo Mutations: 5,669
  • Mosaics: 789
  • Linkage Regions: 172
  • Paper Collected: 6/30/2018
  • Last Update: 8/26/2018