Evidence Details for MACROD2

View Evidences	View Variants	View Annotations

Basic Information Top

Gene Symbol:	MACROD2 ( C20orf133 )
Gene Full Name:	MACRO domain containing 2
Band:	20p12.1
Quick Links	Entrez ID:140733; OMIM: 611567; Uniprot ID:MACD2_HUMAN; ENSEMBL ID: ENSG00000172264; HGNC ID: 16126
Relate to Another Database:	SFARIGene; denovo-db

Sequences Top

Nucleotide Sequence
Protein Sequence

>MACROD2|140733|nucleotide
ATGAATGAGTTTTTCTCCGTAGACGATAATAATGAAGAAGAAGAGGATGTTGAAATGAAAGAAGATTCAGATGAGAACGGTCCAGAGGAGAAGCAAAGTGTGGAA
GAAATGGAAGAGCAGAGCCAAGATGCAGATGGTGTCAACACTGTCACTGTGCCCGGCCCTGCTTCAGAAGAGGCAGTTGAAGACTGTAAAGATGAAGATTTTGCA
AAGGATGAAAATATTACAAAAGGCGGTGAAGTGACAGATCATTCTGTGCGTGACCAAGATCATCCCGATGGACAAGAGAATGATTCAACGAAGAATGAAATAAAA
ATTGAAACAGAATCGCAGAGCTCATATATGGAAACAGAAGAACTTTCATCAAACCAAGAAGATGCCGTGATTGTGGAGCAACCAGAAGTGATTCCATTAACAGAG
GACCAAGAAGAAAAAGAAGGTGAAAAAGCTCCAGGCGAGGACACACCTAGGATGCCTGGGAAAAGTGAAGGCTCCAGTGACCTAGAAAATACTCCAGGTCCTGAT
GTTGAAATGAATAGTCAGGTTGACAAGGTAAATGACCCAACAGAGAGTCAACAAGAAGATCAACTAATAGCAGGGGCACAAGATGAAGCGAAGGAACAAAGAAAT
GGAACTAAATGA

Show »

Evidence summary Top

Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default.

Evidences	Syndromic Gene	GWAS	CNV	Linkage	Association	Expression	NGS de novo	NGS Mosaic	NGS Other	Low-Scale Gene Studies	Total
Score (No. of Studies)	No	3 (4)	0 (4)	0 (0)	2 (7)	0 (0)	0 (1)	0 (0)	0 (0)	0 (0)	16 (16)

Syndromic Autism Gene Top

Genome-Wide Association Studies (By Ethnic Group) Top

Family Based Association Studies: 4

Reference	Stage	Platform	#Families	Affecteds						Result
Reference	Stage	Platform	#Families	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)	Result
CAUCASIAN
Anney, 2010_1	Discovery	Illumina Human 1M-single Infinium BeadChip	1369	1385 (-)			ASD	- -	- -
Anney, 2010_2	Replication	Illumina Human 1M-single Infinium BeadChip	595	1086 (-)			ASD	- -	- -
Hussman, 2011_1	Discovery	Illumina Infinium Human 1 M beadship	597	- (-)			ASD	- -	- -
MIXED/OTHERS
Anney R, 2012_2	-	Illumina Infinium 1M-single SNP microarray; Illumina 1M-duo microarray	2705	- (-)			ASD	- -	- -

Case Control Based Association Studies: 0

Reference	Stage	Platform	ASD Cases						Normal Controls		Result
Reference	Stage	Platform	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)	Result
No Evidence.

CNV Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
Gregory, 2009	USA	aCGH			ASD	-	-	-	-	119	54	173
Pinto, 2010	-	SNP microarray, qPCR			ASD	-	-	-	-	996	1287	2283
Gai, 2011	AGRE	SNP microarray	-	-	autism	-	-	-	-	1224	3801	5025
Sanders, 2011	Simons Simplex Collection	SNP microarray	-	-	ASD	1127	1127	-	-	-	-	-

Linkage Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family	Individual
Total	Simplex	Multiplex	Control	Affected	Control	Total
No Matched Linkage Regions !

Low Scale Association Studies (by Ethnic Group) Top

Family Based Association Studies: 2

Reference	Source	Platform	#Families	Affecteds						Result
Reference	Source	Platform	#Families	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)	Result
MIXED/OTHERS
Prandini P, 2012_1	Italian	TaqMan allelic discrimination assays	227	233 (13.73%)			ASD	- -	- -
Jones RM, 2014_1	Unknown	Illumina Human 660W Quad Array	-	965 (-)			autistic-like trait	20 years -	- -

Case Control Based Association Studies: 5

Reference	Source	Platfrom	ASD Cases					Normal Controls		Result
Reference	Source	Platfrom	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)	Result
CAUCASIAN
Curran, 2011_5	Iceland	-	-	-	-	- -	-	32625 (-)	- -
Curran, 2011_3	NL	-			ASD	- -	-	628 (-)	- -
Curran, 2011_1	UK	-			ASD	- -	-	820 (-)	- -
Curran, 2011_4	Italy	-			ASD	- -	-	89 (-)	- -
Curran, 2011_2	Germany	-			ASD	- -	-	1145 (-)	- -

Large Scale Expression Studies Top

Reference	Source	Tissue	#Subjects (% Women)	ADI-R	ADOS	Endo- pheno	Diagnosis	Normal Controls (% Women)	Fold Change	Up/ Down	P/Q value
No Evidence.

Reference	Source	Tissue	Platform	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Normal Controls(% Women)
No Evidence.

NGS de novo Mutation Studies Top

Reference	Case Number	Family Number	de novo Number	Title
Michaelson JJ, 2012	-	10	565	Whole-genome sequencing in autism identifies hot spots for de novo germline mutation.

NGS Mosaic SNV Studies Top

Reference	Case Number	Family Number	Mosaic Number	Title
No matched NGS Mosaic SNVs!

NGS Other Studies Top

Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Family			Affected	Validation Method
Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Affected	Validation Method
No matched NGS Other Studies!

Low Scale Gene Studies Top

Reference	Organism	Tissue	ADI-R	ADOS	Diagnosis	Evidence Level	Result
No Evidence.

Contact Us if you are an author of a study regarding this gene and do not find your study in this table or find errors in the representation of your study details.

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics

Studies: 1,036
Genes: 1,379
CNVs/SVs: 5,420
SNVs/Indels: 11,669
de novo Mutations: 5,669
Mosaics: 789
Linkage Regions: 172

Paper Collected: 6/30/2018

Last Update: 8/26/2018

AutismKB 2.0

Evidence Details for MACROD2

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics