Evidence Details for PPP1R1C

View Evidences	View Variants	View Annotations

Basic Information Top

Gene Symbol:	PPP1R1C ( IPP5 )
Gene Full Name:	protein phosphatase 1, regulatory (inhibitor) subunit 1C
Band:	2q31.3-q32.1
Quick Links	Entrez ID:151242; OMIM: 613240; Uniprot ID:PPR1C_HUMAN; ENSEMBL ID: ENSG00000150722; HGNC ID: 14940
Relate to Another Database:	SFARIGene; denovo-db

Sequences Top

Nucleotide Sequence
Protein Sequence

>PPP1R1C|151242|nucleotide
ATGGAGCCCAACAGTCCCAAAAAGATACAGTTTGCCGTGCCTGTATTCCAGAGTCAGATTGCACCTGAAGCAGCAGAGCAGATCAGGAAAAGAAGACCTACACCA
GCATCACTTGTGATTCTCAATGAGCATAACCCCCCAGAAATAGATGACAAGAGGGGGCCCAACACACAAGGGGAATTACAGAATGCATCCCCTAAGCAAAGGAAG
CAGAGTGTGTACACACCACCCACCATAAAAGGGGTTAAGCATCTGAAAGGCCAGAATGAATCAGCATTCCCTGAAGAAGAAGAAGGCACCAATGAAAGAGAGGAG
CAGCGGGACCATTAA

Show »

Evidence summary Top

Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default.

Evidences	Syndromic Gene	GWAS	CNV	Linkage	Association	Expression	NGS de novo	NGS Mosaic	NGS Other	Low-Scale Gene Studies	Total
Score (No. of Studies)	No	0 (0)	1 (1)	1 (2)	0 (1)	0 (0)	0 (1)	0 (0)	0 (0)	0 (0)	4 (5)

Syndromic Autism Gene Top

Genome-Wide Association Studies(By Ethnic Group) Top

Reference	Stage	Platform	#Families	Affecteds	Result
#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)
No Evidence.

Reference	Stage	Platform	ASD Cases	Normal Controls	Result
#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)
No Evidence.

CNV Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
Gallagher, 2003	-	Chromosomal analysis of G-band			autism	-	-	-	-	1	-	1

Linkage Studies Top

AutismKB 2.0

Evidence Details for PPP1R1C