Evidence Details for EN2

View Evidences	View Variants	View Annotations

Basic Information Top

Gene Symbol:	EN2 ( - )
Gene Full Name:	engrailed homeobox 2
Band:	7q36.3
Quick Links	Entrez ID:2020; OMIM: 131310; Uniprot ID:HME2_HUMAN; ENSEMBL ID: ENSG00000164778; HGNC ID: 3343
Relate to Another Database:	SFARIGene; denovo-db

Sequences Top

Nucleotide Sequence
Protein Sequence

>EN2|2020|nucleotide
ATGGAGGAGAATGACCCCAAGCCTGGCGAAGCAGCGGCGGCGGTGGAGGGACAGCGGCAGCCGGAATCCAGCCCCGGCGGCGGCTCGGGCGGCGGCGGCGGTAGC
AGCCCGGGCGAAGCGGACACCGGGCGCCGGCGGGCTCTGATGCTGCCCGCGGTCCTGCAGGCGCCCGGCAACCACCAGCACCCGCACCGCATCACCAACTTCTTC
ATCGACAACATCCTGCGGCCCGAGTTCGGCCGGCGAAAGGACGCGGGGACCTGCTGTGCGGGCGCGGGAGGAGGAAGGGGCGGCGGAGCCGGCGGCGAAGGCGGC
GCGAGCGGTGCGGAGGGAGGCGGCGGCGCGGGCGGCTCGGAGCAGCTCTTGGGCTCGGGCTCCCGAGAGCCCCGGCAGAACCCGCCATGTGCGCCCGGCGCGGGC
GGGCCGCTCCCAGCCGCCGGCAGCGACTCTCCGGGTGACGGGGAAGGCGGCTCCAAGACGCTCTCGCTGCACGGTGGCGCCAAGAAAGGCGGCGACCCCGGCGGC
CCCCTGGACGGGTCGCTCAAGGCCCGCGGCTTGGGCGGCGGCGACCTGTCGGTGAGCTCGGACTCGGACAGCTCGCAAGCCGGCGCCAACCTGGGCGCGCAGCCC
ATGCTCTGGCCGGCGTGGGTCTACTGTACGCGCTACTCGGACCGGCCTTCTTCAGGTCCCAGGTCTCGAAAACCAAAGAAGAAGAACCCGAACAAAGAGGACAAG
CGGCCGCGCACGGCCTTTACCGCCGAGCAGCTGCAGAGGCTCAAGGCCGAGTTCCAGACCAACAGGTACCTGACGGAGCAGCGGCGCCAGAGCCTGGCGCAGGAG
CTGAGCCTCAACGAGTCACAGATCAAGATTTGGTTCCAGAACAAGCGCGCCAAGATCAAGAAGGCCACGGGCAACAAGAACACGCTGGCCGTGCACCTCATGGCA
CAGGGCTTGTACAACCACTCCACCACAGCCAAGGAGGGCAAGTCGGACAGCGAGTAG

Show »

Evidence summary Top

Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default.

Evidences	Syndromic Gene	GWAS	CNV	Linkage	Association	Expression	NGS de novo	NGS Mosaic	NGS Other	Low-Scale Gene Studies	Total
Score (No. of Studies)	No	0 (1)	0 (0)	0 (0)	3 (12)	0 (0)	0 (0)	0 (0)	0 (0)	3 (3)	36 (16)

Syndromic Autism Gene Top

Genome-Wide Association Studies (By Ethnic Group) Top

Family Based Association Studies: 1

Reference	Stage	Platform	#Families	Affecteds						Result
Reference	Stage	Platform	#Families	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)	Result
CAUCASIAN
Hussman, 2011_1	Discovery	Illumina Infinium Human 1 M beadship	597	- (-)			ASD	- -	- -

Case Control Based Association Studies: 0

Reference	Stage	Platform	ASD Cases						Normal Controls		Result
Reference	Stage	Platform	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)	Result
No Evidence.

CNV Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family	Individual
Total	Simplex	Multiplex	Control	Affected	Control	Total
No matched CNVs !

Linkage Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family	Individual
Total	Simplex	Multiplex	Control	Affected	Control	Total
No Matched Linkage Regions !

Low Scale Association Studies (by Ethnic Group) Top

Family Based Association Studies: 9

Reference	Source	Platform	#Families	Affecteds						Result
Reference	Source	Platform	#Families	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)	Result
CAUCASIAN
Zhong, 2003_1	AGRE	restriction enzyme based assay using Alu1	196	437 (-)			ASD	- -	- -
Gharani, 2004_1	AGRE	tetraprimer Amplification Refreactory Mutation System-PCR	167	167 (-)			ASD	- -	- -
Benayed, 2005_1	AGRE	simplex Pyrosequencing assays and the atomated PSQ HS 96 A	167	- (-)			ASD	- -	- -
Benayed, 2005_3	NIMH	simplex Pyrosequencing assays and the atomated PSQ HS 96 A	129	- (-)			ASD	- -	- -
Benayed, 2005_2	AGRE	simplex Pyrosequencing assays and the atomated PSQ HS 96 A	222	- (-)			ASD	- -	- -
Sen, 2010_1	India	ABI 3130 Genetic analyzer	128	128 (17.19%)			ASD	5.98±3.1 -	- -
Carayol, 2010_1	USA	direct genotyping	222	527 (22.22%)			autism	- -	- -
ASIAN
Wang, 2008_1	China	PCR-RFLP, ABI PRISM 377-96 DNA Sequencer	210	210 (6.67%)			AD	6.5 (2-17)	- -
MIXED/OTHERS
Brune, 2008_1	USA	Perkin Elmer 9700 thermocycler, LJL Analyst AD fluorescence microplate reader	643	- (-)			ASD,AD	- -	- -

Case Control Based Association Studies: 3

Reference	Source	Platfrom	ASD Cases					Normal Controls		Result
Reference	Source	Platfrom	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)	Result
CAUCASIAN
Petit, 1995_1	USA	-			AD	7.33 (2-16)	-	100 (46.00%)	8.17 -
ASIAN
Yang, 2008_2	China	ABI3130 Genetic Analyzer			ASD	7.06±4.35 -	-	225 (-)	18.82±5.36 -
Yang, 2008_1	China	TaqMan SNP genotyping assay			ASD	7.06±4.35 -	-	409 (-)	45.14±14 -

Large Scale Expression Studies Top

Reference	Source	Tissue	#Subjects (% Women)	ADI-R	ADOS	Endo- pheno	Diagnosis	Normal Controls (% Women)	Fold Change	Up/ Down	P/Q value
No Evidence.

Reference	Source	Tissue	Platform	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Normal Controls(% Women)
No Evidence.

NGS de novo Mutation Studies Top

Reference	Case Number	Family Number	de novo Number	Title
No matched NGS de novo Mutation Studies!

NGS Mosaic SNV Studies Top

Reference	Case Number	Family Number	Mosaic Number	Title
No matched NGS Mosaic SNVs!

NGS Other Studies Top

Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Family	Affected	Validation Method
Total	Simplex	Multiplex
No matched NGS Other Studies!

Low Scale Gene Studies Top

Reference	Organism	Tissue	ADI-R	ADOS	Diagnosis	Evidence Level	Result
No Evidence.

Contact Us if you are an author of a study regarding this gene and do not find your study in this table or find errors in the representation of your study details.

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics

Studies: 1,036
Genes: 1,379
CNVs/SVs: 5,420
SNVs/Indels: 11,669
de novo Mutations: 5,669
Mosaics: 789
Linkage Regions: 172

Paper Collected: 6/30/2018

Last Update: 8/26/2018

AutismKB 2.0

Evidence Details for EN2

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics