Evidence Details for ZHX2

View Evidences	View Variants	View Annotations

Basic Information Top

Gene Symbol:	ZHX2 ( AFR1,KIAA0854,RAF )
Gene Full Name:	zinc fingers and homeoboxes 2
Band:	8q24.13
Quick Links	Entrez ID:22882; OMIM: 609185; Uniprot ID:ZHX2_HUMAN; ENSEMBL ID: ENSG00000178764; HGNC ID: 18513
Relate to Another Database:	SFARIGene; denovo-db

Sequences Top

Nucleotide Sequence
Protein Sequence

>ZHX2|22882|nucleotide
ATGGCTAGCAAACGAAAATCTACAACTCCATGCATGGTTCGGACATCACAAGTAGTAGAACAAGATGTGCCCGAGGAAGTAGACAGGGCCAAAGAGAAAGGAATC
GGCACACCACAGCCTGACGTGGCCAAGGACAGTTGGGCAGCAGAACTTGAAAACTCTTCCAAAGAAAACGAAGTGATAGAGGTGAAATCTATGGGGGAAAGCCAG
TCCAAAAAACTCCAAGGTGGTTATGAGTGCAAATACTGCCCCTACTCCACGCAAAACCTGAACGAGTTCACGGAGCATGTCGACATGCAGCATCCCAACGTGATT
CTCAACCCCCTCTACGTGTGTGCAGAATGTAACTTCACAACCAAAAAGTACGACTCCCTATCCGACCACAACTCCAAGTTCCATCCCGGGGAGGCCAACTTCAAG
CTGAAGTTAATTAAACGCAATAATCAAACTGTCTTGGAACAGTCCATCGAAACCACCAACCATGTCGTGTCCATCACCACCAGTGGCCCTGGAACTGGTGACAGT
GATTCTGGGATCTCGGTGAGTAAAACCCCCATCATGAAGCCTGGAAAACCAAAAGCGGATGCCAAGAAGGTGCCCAAGAAGCCCGAGGAGATCACCCCCGAGAAC
CACGTGGAAGGGACCGCCCGCCTGGTGACAGACACAGCTGAGATCCTCTCGAGACTCGGCGGGGTGGAGCTCCTCCAAGACACATTAGGACACGTCATGCCTTCT
GTACAGCTGCCACCAAATATCAACCTTGTGCCCAAGGTCCCTGTCCCACTAAATACTACCAAATACAACTCTGCCCTGGATACAAATGCCACGATGATCAACTCT
TTCAACAAGTTTCCTTACCCGACCCAGGCTGAGTTGTCCTGGCTGACAGCTGCCTCCAAACACCCAGAGGAGCACATCAGAATCTGGTTTGCCACCCAGCGCTTA
AAGCATGGCATCAGCTGGTCCCCAGAAGAGGTGGAGGAGGCCCGGAAGAAGATGTTCAACGGCACCATCCAGTCAGTACCCCCGACCATCACTGTGCTGCCCGCC
CAGTTGGCCCCCACAAAGGTGACGCAGCCCATCCTCCAGACGGCTCTACCGTGCCAGATCCTCGGCCAGACTAGCCTGGTGCTGACTCAGGTGACCAGCGGGTCA
Show »

Evidence summary Top

Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default.

Evidences	Syndromic Gene	GWAS	CNV	Linkage	Association	Expression	NGS de novo	NGS Mosaic	NGS Other	Low-Scale Gene Studies	Total
Score (No. of Studies)	No	0 (1)	0 (1)	1 (3)	0 (0)	2 (2)	0 (0)	0 (0)	0 (0)	0 (0)	4 (7)

Syndromic Autism Gene Top

Genome-Wide Association Studies (By Ethnic Group) Top

Family Based Association Studies: 1

Reference	Stage	Platform	#Families	Affecteds						Result
Reference	Stage	Platform	#Families	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)	Result
CAUCASIAN
Hussman, 2011_1	Discovery	Illumina Infinium Human 1 M beadship	597	- (-)			ASD	- -	- -

Case Control Based Association Studies: 0

Reference	Stage	Platform	ASD Cases						Normal Controls		Result
Reference	Stage	Platform	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)	Result
No Evidence.

CNV Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
Szatmari, 2007	Europe, North America	SNP microarray			ASD	1491	-	-	-	-	-	0

Linkage Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
Yonan, 2003	USA	microsatellite-based genomic screen			PDD	345	-	345	-	-	-	-
Liu, 2001	USA	microsatellite-based genomic screen			autism, ASD	110	-	110	-	-	-	-
Ylisaukko-oja, 2006	USA, Finland	microsatellite-based genomic screen			ASD	314	-	314	-	-	-	-

Low Scale Association Studies (by Ethnic Group) Top

Reference	Source	Platform	#Families	Affecteds	Result
#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)
No Evidence.

Reference	Source	Platfrom	ASD Cases	Normal Controls	Result
ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)
No Evidence.

Large Scale Expression Studies Top

Microarray Studies: 2

Reference	Source	Tissue	#Subjects (% Women)	Endo- pheno	Diagnosis	Normal Controls (% Women)	Fold Change	Up/ Down	P/Q value
Ghahramani Seno, 2010_1	Unknown	lymphoblastoid cell-line	20 (35.00%)	-	AD	22 (13.64%)	1.26	Up	0.021
Platform: Illumina HumanRef-8_V3 gene expression arrays (San Diego, USA) ProbeSet: ILMN_2184966 RefSeq_ID/ EST: - GEO_ID: - Statistic Method: Generalized Estimating Equations (GEE)
Voineagu, 2011_1	Unknown	16 frontal cortex(BA9) and 13 temporal cortex(BA41	16 (25.00%)	-	autism	16 (6.25%)	1.33883	Up	1.1752
Platform: Illumina Ref8 v3 microarrays ProbeSet: ILMN_2184966 RefSeq_ID/ EST: - GEO_ID: GSE28521 Statistic Method: SAM package and unless otherwise specified the significance threshold was FDR,0.05 and fold changes.1.3.

Proteomics Studies:0

Reference	Source	Tissue	Platform	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Normal Controls(% Women)
No Evidence.

NGS de novo Mutation Studies Top

Reference	Case Number	Family Number	de novo Number	Title
No matched NGS de novo Mutation Studies!

NGS Mosaic SNV Studies Top

Reference	Case Number	Family Number	Mosaic Number	Title
No matched NGS Mosaic SNVs!

NGS Other Studies Top

Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Family			Affected	Validation Method
Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Affected	Validation Method
No matched NGS Other Studies!

Low Scale Gene Studies Top

Reference	Organism	Tissue	ADI-R	ADOS	Diagnosis	Evidence Level	Result
No Evidence.

Contact Us if you are an author of a study regarding this gene and do not find your study in this table or find errors in the representation of your study details.

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics

Studies: 1,036
Genes: 1,379
CNVs/SVs: 5,420
SNVs/Indels: 11,669
de novo Mutations: 5,669
Mosaics: 789
Linkage Regions: 172

Paper Collected: 6/30/2018

Last Update: 8/26/2018

AutismKB 2.0

Evidence Details for ZHX2

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics