Evidence Details for ZFR2


Gene Symbol: | ZFR2 ( KIAA1086 ) |
---|---|
Gene Full Name: | zinc finger RNA binding protein 2 |
Band: | 19p13.3 |
Quick Links | Entrez ID:23217; OMIM: NA; Uniprot ID:ZFR2_HUMAN; ENSEMBL ID: ENSG00000105278; HGNC ID: 29189 |
Relate to Another Database: | SFARIGene; denovo-db |


>ZFR2|23217|nucleotide
ATGGCGACGAGTCAGTATTTCGACTTCGCGCAGGGCGGCGGCCCGCAGTACAGTCCAGAAGTGGAGACCACTCCCCCGGCCCTTGCATCTGGGCTTCCTTGTGCC
CTGCCTTGGACAGTTGGCTGCAGTGGAAGTGACGCTGTGACTGCCCTGTGCCCAAGCTTAAGAGGCCTTGCCTGCATCTGCTCCATCTTATGGGACCCTGCCTGG
TGA
Show »
ATGGCGACGAGTCAGTATTTCGACTTCGCGCAGGGCGGCGGCCCGCAGTACAGTCCAGAAGTGGAGACCACTCCCCCGGCCCTTGCATCTGGGCTTCCTTGTGCC
CTGCCTTGGACAGTTGGCTGCAGTGGAAGTGACGCTGTGACTGCCCTGTGCCCAAGCTTAAGAGGCCTTGCCTGCATCTGCTCCATCTTATGGGACCCTGCCTGG
TGA
Show »


Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default.
Evidences | Syndromic Gene | GWAS | CNV | Linkage | Association | Expression | NGS de novo | NGS Mosaic | NGS Other | Low-Scale Gene Studies | Total |
---|---|---|---|---|---|---|---|---|---|---|---|
Score (No. of Studies) | No | 0 (0) | 1 (3) | 1 (1) | 0 (0) | 0 (0) | 1 (2) | 0 (0) | 0 (0) | 0 (0) | 14 (6) |






Reference | Source | Method | ADI-R | ADOS | Diagnosis | Family | Individual | |||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Total | Simplex | Multiplex | Control | Affected | Control | Total | ||||||
Bucan, 2009 | USA | SNP microarray | ![]() | ![]() | autism, ASD | 912 | - | 912 | - | - | 1488 | 1488 |
Gregory, 2009 | USA | aCGH | ![]() | ![]() | ASD | - | - | - | - | 119 | 54 | 173 |
Levy, 2011 | Simons Simplex Collection | aCGH | - | - | ASD | 915 | 915 | - | - | - | - | - |


Reference | Source | Method | ADI-R | ADOS | Diagnosis | Family | Individual | |||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Total | Simplex | Multiplex | Control | Affected | Control | Total | ||||||
Schellenberg, 2006 | USA | microsatellite-based genomic screen | ![]() | ![]() | autism | 222 | - | 222 | - | - | - | - |






Reference | Case Number | Family Number | de novo Number | Title |
---|---|---|---|---|
De Rubeis S, 2014 | 2270 | - | 1702 | Synaptic, transcriptional and chromatin genes disrupted in autism |
Iossifov I, 2014 | 2508 | - | 1194 | The contribution of de novo coding mutations to autism spectrum disorder. |






Contact Us if you are an author of a study regarding this gene and do not find your study in this table or find errors in the representation of your study details.