Evidence Details for ZFR2
Basic Information Top
| Gene Symbol: | ZFR2 ( KIAA1086 ) |
|---|---|
| Gene Full Name: | zinc finger RNA binding protein 2 |
| Band: | 19p13.3 |
| Quick Links | Entrez ID:23217; OMIM: NA; Uniprot ID:ZFR2_HUMAN; ENSEMBL ID: ENSG00000105278; HGNC ID: 29189 |
| Relate to Another Database: | SFARIGene; denovo-db |
Sequences Top
>ZFR2|23217|nucleotide
ATGGCGACGAGTCAGTATTTCGACTTCGCGCAGGGCGGCGGCCCGCAGTACAGTCCAGAAGTGGAGACCACTCCCCCGGCCCTTGCATCTGGGCTTCCTTGTGCC
CTGCCTTGGACAGTTGGCTGCAGTGGAAGTGACGCTGTGACTGCCCTGTGCCCAAGCTTAAGAGGCCTTGCCTGCATCTGCTCCATCTTATGGGACCCTGCCTGG
TGA
Show »
ATGGCGACGAGTCAGTATTTCGACTTCGCGCAGGGCGGCGGCCCGCAGTACAGTCCAGAAGTGGAGACCACTCCCCCGGCCCTTGCATCTGGGCTTCCTTGTGCC
CTGCCTTGGACAGTTGGCTGCAGTGGAAGTGACGCTGTGACTGCCCTGTGCCCAAGCTTAAGAGGCCTTGCCTGCATCTGCTCCATCTTATGGGACCCTGCCTGG
TGA
Show »
Evidence summary Top
Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default.
| Evidences | Syndromic Gene | GWAS | CNV | Linkage | Association | Expression | NGS de novo | NGS Mosaic | NGS Other | Low-Scale Gene Studies | Total |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Score (No. of Studies) | No | 0 (0) | 1 (3) | 1 (1) | 0 (0) | 0 (0) | 1 (2) | 0 (0) | 0 (0) | 0 (0) | 14 (6) |
Syndromic Autism Gene Top
Genome-Wide Association Studies(By Ethnic Group) Top
CNV Studies Top
| Reference | Source | Method | ADI-R | ADOS | Diagnosis | Family | Individual | |||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Total | Simplex | Multiplex | Control | Affected | Control | Total | ||||||
| Bucan, 2009 | USA | SNP microarray | ![]() | ![]() | autism, ASD | 912 | - | 912 | - | - | 1488 | 1488 |
| Gregory, 2009 | USA | aCGH | ![]() | ![]() | ASD | - | - | - | - | 119 | 54 | 173 |
| Levy, 2011 | Simons Simplex Collection | aCGH | - | - | ASD | 915 | 915 | - | - | - | - | - |
Linkage Studies Top
| Reference | Source | Method | ADI-R | ADOS | Diagnosis | Family | Individual | |||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Total | Simplex | Multiplex | Control | Affected | Control | Total | ||||||
| Schellenberg, 2006 | USA | microsatellite-based genomic screen | ![]() | ![]() | autism | 222 | - | 222 | - | - | - | - |
Low Scale Association Studies (by Ethnic Group) Top
Large Scale Expression Studies Top
NGS de novo Mutation Studies Top
| Reference | Case Number | Family Number | de novo Number | Title |
|---|---|---|---|---|
| De Rubeis S, 2014 | 2270 | - | 1702 | Synaptic, transcriptional and chromatin genes disrupted in autism |
| Iossifov I, 2014 | 2508 | - | 1194 | The contribution of de novo coding mutations to autism spectrum disorder. |
NGS Mosaic SNV Studies Top
NGS Other Studies Top
Low Scale Gene Studies Top
Contact Us if you are an author of a study regarding this gene and do not find your study in this table or find errors in the representation of your study details.



