Evidence Details for SEC61G

View Evidences	View Variants	View Annotations

Basic Information Top

Gene Symbol:	SEC61G ( SSS1 )
Gene Full Name:	Sec61 gamma subunit
Band:	7p11.2
Quick Links	Entrez ID:23480; OMIM: 609215; Uniprot ID:SC61G_HUMAN; ENSEMBL ID: ENSG00000132432; HGNC ID: 18277
Relate to Another Database:	SFARIGene; denovo-db

Sequences Top

Nucleotide Sequence
Protein Sequence

>SEC61G|23480|nucleotide
ATGGATCAGGTAATGCAGTTTGTTGAGCCAAGTCGGCAGTTTGTAAAGGACTCCATTCGGCTGGTTAAAAGATGCACTAAACCTGATAGAAAAGAATTCCAGAAG
ATTGCCATGGCAACAGCAATAGGATTTGCTATAATGGGATTCATTGGCTTCTTTGTGAAATTGATCCATATTCCTATTAATAACATCATTGTTGGTGGCTGA

Show »

Evidence summary Top

Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default.

Evidences	Syndromic Gene	GWAS	CNV	Linkage	Association	Expression	NGS de novo	NGS Mosaic	NGS Other	Low-Scale Gene Studies	Total
Score (No. of Studies)	No	0 (0)	1 (1)	1 (1)	0 (0)	0 (0)	0 (1)	0 (0)	0 (0)	0 (0)	4 (3)

Syndromic Autism Gene Top

Genome-Wide Association Studies(By Ethnic Group) Top

Reference	Stage	Platform	#Families	Affecteds	Result
#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)
No Evidence.

Reference	Stage	Platform	ASD Cases	Normal Controls	Result
#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)
No Evidence.

CNV Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
Wolpert, 2001	-	FISH			autism	-	-	-	-	1	-	1

Linkage Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
Allen-Brady, 2008	-	SNP-based genomic screen			ASD	1	-	1	-	7	22	29

Low Scale Association Studies (by Ethnic Group) Top

Reference	Source	Platform	#Families	Affecteds	Result
#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)
No Evidence.

Reference	Source	Platfrom	ASD Cases	Normal Controls	Result
ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)
No Evidence.

Large Scale Expression Studies Top

Reference	Source	Tissue	#Subjects (% Women)	ADI-R	ADOS	Endo- pheno	Diagnosis	Normal Controls (% Women)	Fold Change	Up/ Down	P/Q value
No Evidence.

Reference	Source	Tissue	Platform	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Normal Controls(% Women)
No Evidence.

NGS de novo Mutation Studies Top

Reference	Case Number	Family Number	de novo Number	Title
Nilsson D, 2017	8	-	17	Whole-Genome Sequencing of Cytogenetically Balanced Chromosome Translocations Identifies Potentially

NGS Mosaic SNV Studies Top

Reference	Case Number	Family Number	Mosaic Number	Title
No matched NGS Mosaic SNVs!

NGS Other Studies Top

Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Family			Affected	Validation Method
Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Affected	Validation Method
No matched NGS Other Studies!

Low Scale Gene Studies Top

Reference	Organism	Tissue	ADI-R	ADOS	Diagnosis	Evidence Level	Result
No Evidence.

Contact Us if you are an author of a study regarding this gene and do not find your study in this table or find errors in the representation of your study details.

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics

Studies: 1,036
Genes: 1,379
CNVs/SVs: 5,420
SNVs/Indels: 11,669
de novo Mutations: 5,669
Mosaics: 789
Linkage Regions: 172

Paper Collected: 6/30/2018

Last Update: 8/26/2018

AutismKB 2.0

Evidence Details for SEC61G

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics