Evidence Details for SEC61G
Basic Information Top
Gene Symbol: | SEC61G ( SSS1 ) |
---|---|
Gene Full Name: | Sec61 gamma subunit |
Band: | 7p11.2 |
Quick Links | Entrez ID:23480; OMIM: 609215; Uniprot ID:SC61G_HUMAN; ENSEMBL ID: ENSG00000132432; HGNC ID: 18277 |
Relate to Another Database: | SFARIGene; denovo-db |
Sequences Top
>SEC61G|23480|nucleotide
ATGGATCAGGTAATGCAGTTTGTTGAGCCAAGTCGGCAGTTTGTAAAGGACTCCATTCGGCTGGTTAAAAGATGCACTAAACCTGATAGAAAAGAATTCCAGAAG
ATTGCCATGGCAACAGCAATAGGATTTGCTATAATGGGATTCATTGGCTTCTTTGTGAAATTGATCCATATTCCTATTAATAACATCATTGTTGGTGGCTGA
Show »
ATGGATCAGGTAATGCAGTTTGTTGAGCCAAGTCGGCAGTTTGTAAAGGACTCCATTCGGCTGGTTAAAAGATGCACTAAACCTGATAGAAAAGAATTCCAGAAG
ATTGCCATGGCAACAGCAATAGGATTTGCTATAATGGGATTCATTGGCTTCTTTGTGAAATTGATCCATATTCCTATTAATAACATCATTGTTGGTGGCTGA
Show »
Evidence summary Top
Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default.
Evidences | Syndromic Gene | GWAS | CNV | Linkage | Association | Expression | NGS de novo | NGS Mosaic | NGS Other | Low-Scale Gene Studies | Total |
---|---|---|---|---|---|---|---|---|---|---|---|
Score (No. of Studies) | No | 0 (0) | 1 (1) | 1 (1) | 0 (0) | 0 (0) | 0 (1) | 0 (0) | 0 (0) | 0 (0) | 4 (3) |
Syndromic Autism Gene Top
Genome-Wide Association Studies(By Ethnic Group) Top
CNV Studies Top
Reference | Source | Method | ADI-R | ADOS | Diagnosis | Family | Individual | |||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Total | Simplex | Multiplex | Control | Affected | Control | Total | ||||||
Wolpert, 2001 | - | FISH | autism | - | - | - | - | 1 | - | 1 |
Linkage Studies Top
Reference | Source | Method | ADI-R | ADOS | Diagnosis | Family | Individual | |||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Total | Simplex | Multiplex | Control | Affected | Control | Total | ||||||
Allen-Brady, 2008 | - | SNP-based genomic screen | ASD | 1 | - | 1 | - | 7 | 22 | 29 |
Low Scale Association Studies (by Ethnic Group) Top
Large Scale Expression Studies Top
NGS de novo Mutation Studies Top
Reference | Case Number | Family Number | de novo Number | Title |
---|---|---|---|---|
Nilsson D, 2017 | 8 | - | 17 | Whole-Genome Sequencing of Cytogenetically Balanced Chromosome Translocations Identifies Potentially |
NGS Mosaic SNV Studies Top
NGS Other Studies Top
Low Scale Gene Studies Top
Contact Us if you are an author of a study regarding this gene and do not find your study in this table or find errors in the representation of your study details.