Evidence Details for CNTNAP2

View Evidences	View Variants	View Annotations

Basic Information Top

Gene Symbol:	CNTNAP2 ( AUTS15,CASPR2,CDFE,DKFZp781D1846,NRXN4,PTHSL1 )
Gene Full Name:	contactin associated protein-like 2
Band:	7q35-q36.1
Quick Links	Entrez ID:26047; OMIM: 604569; Uniprot ID:CNTP2_HUMAN; ENSEMBL ID: ENSG00000174469; HGNC ID: 13830
Relate to Another Database:	SFARIGene; denovo-db

Sequences Top

Nucleotide Sequence
Protein Sequence

>CNTNAP2|26047|nucleotide
ATGCAGGCGGCTCCGCGCGCCGGCTGCGGGGCAGCGCTCCTGCTGTGGATTGTCAGCAGCTGCCTCTGCAGAGCCTGGACGGCTCCCTCCACGTCCCAAAAATGT
GATGAGCCACTTGTCTCTGGACTCCCCCATGTGGCTTTCAGCAGCTCCTCCTCCATCTCTGGTAGCTATTCTCCCGGCTATGCCAAGATAAACAAGAGAGGAGGT
GCTGGGGGATGGTCTCCATCAGACAGCGACCATTATCAATGGCTTCAGGTTGACTTTGGCAATCGGAAGCAGATCAGTGCCATTGCAACCCAAGGAAGGTATAGC
AGCTCAGATTGGGTGACCCAATACCGGATGCTCTACAGCGACACAGGGAGAAACTGGAAACCCTATCATCAAGATGGGAATATCTGGGCATTTCCCGGAAACATT
AACTCTGACGGTGTGGTCCGGCACGAATTACAGCATCCGATTATTGCCCGCTATGTGCGCATAGTGCCTCTGGATTGGAATGGAGAAGGTCGCATTGGACTCAGA
ATTGAAGTTTATGGCTGTTCTTACTGGGCTGATGTTATCAACTTTGATGGCCATGTTGTATTACCATATAGATTCAGAAACAAGAAGATGAAAACACTGAAAGAT
GTCATTGCCTTGAACTTTAAGACGTCTGAAAGTGAAGGAGTAATCCTGCACGGAGAAGGACAGCAAGGAGATTACATTACCTTGGAACTGAAAAAAGCCAAGCTG
GTCCTCAGTTTAAACTTAGGAAGCAACCAGCTTGGCCCCATATATGGCCACACATCAGTGATGACAGGAAGTTTGCTGGATGACCACCACTGGCACTCTGTGGTC
ATTGAGCGCCAGGGGCGGAGCATTAACCTCACTCTGGACAGGAGCATGCAGCACTTCCGTACCAATGGAGAGTTTGACTACCTGGACTTGGACTATGAGATAACC
TTTGGAGGCATCCCTTTCTCTGGCAAGCCCAGCTCCAGCAGTAGAAAGAATTTCAAAGGCTGCATGGAAAGCATCAACTACAATGGCGTCAACATTACTGATCTT
GCCAGAAGGAAGAAATTAGAGCCCTCAAATGTGGGAAATTTGAGCTTTTCTTGTGTGGAACCCTATACGGTGCCTGTCTTTTTCAACGCTACAAGTTACCTGGAG
Show »

Evidence summary Top

Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default.

Evidences	Syndromic Gene	GWAS	CNV	Linkage	Association	Expression	NGS de novo	NGS Mosaic	NGS Other	Low-Scale Gene Studies	Total
Score (No. of Studies)	Yes	1 (4)	1 (6)	1 (3)	3 (9)	0 (0)	0 (0)	0 (0)	0 (4)	3 (5)	44 (31)

Syndromic Autism Gene Top

Abbreviations: AD, autosomal dominant; AR, autosomal recessive; ASD, autism spectrum disorder; ID, intellectual disability; XL, X linked.

Inheritance	AR (AD too?)
OMIM	Cortical dysplasia-focal epilepsy syndrome (610042)
Description	Cortical dysplasia-focal epilepsy syndrome and Pitt-Hopkins-like syndrome-1 are autosomal recessive disorders. Deletions or chromosomal rearrangements disrupting a single copy of CNTNAP2 have been reported in patients with ASD, ID, epilepsy, schizophrenia and bipolar disorder as well as in healthy subjects; however, the clinical significance of the disruption of only one allele is unknown
Reference(s)	16571880; 20513142;
Level	Level 4: The disorder is a generally acknowledged ASD related disorder.

Genome-Wide Association Studies (By Ethnic Group) Top

Family Based Association Studies: 4

Reference	Stage	Platform	#Families	Affecteds						Result
Reference	Stage	Platform	#Families	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)	Result
CAUCASIAN
Arking, 2008_2	Replication	Taqman Assay	1295	1295 (-)			ASD	- -	- -
Arking, 2008_1	Discovery	Affymetrix 500K arrays	72	148 (-)			ASD	- -	- -
Hussman, 2011_1	Discovery	Illumina Infinium Human 1 M beadship	597	- (-)			ASD	- -	- -
MIXED/OTHERS
Anney R, 2012_2	-	Illumina Infinium 1M-single SNP microarray; Illumina 1M-duo microarray	2705	- (-)			ASD	- -	- -

Case Control Based Association Studies: 0

Reference	Stage	Platform	ASD Cases						Normal Controls		Result
Reference	Stage	Platform	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)	Result
No Evidence.

CNV Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
Pinto, 2010	-	SNP microarray, qPCR			ASD	-	-	-	-	996	1287	2283
Nord, 2011	US	aCGH	-	-	ASD	-	-	-	-	41	367	408
Gai, 2011	AGRE	SNP microarray	-	-	autism	-	-	-	-	1224	3801	5025
Al-Murrani A, 2012	New Zealand	Chromosome Microarray?	-	-	ASD	1	1	-	-	-	-	-
Egger G, 2014	Austria	Microarray	-	-	ASD	73	-	-	-	245	2357	-
Eriksson MA, 2015	Sweden	FISH?	-	-	autism	-	-	-	-	162	-	162

Linkage Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
McCauley, 2005	-	microsatellite-based genomic screen			autism	158	-	158	-	333	-	-
Liu, 2001	USA	microsatellite-based genomic screen			autism, ASD	110	-	110	-	-	-	-
Molloy, 2005	USA	microsatellite-based genomic screen			ASD	34	-	34	-	-	-	-

Low Scale Association Studies (by Ethnic Group) Top

Family Based Association Studies: 5

Reference	Source	Platform	#Families	Affecteds						Result
Reference	Source	Platform	#Families	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)	Result
CAUCASIAN
Alarcon, 2008_1	AGRE	Perlegen, Southern Caifornia Genotyping Center, Taqman assay	304	- (-)			AD	- -	- -
ASIAN
Li, 2010_1	China	PCR	185	185 (16.22%)			autism	5.1±1.9 -	- -
MIXED/OTHERS
Sampath S, 2013_2	Unknown	TaqMan and Sequenom	2051	- (-)			-	- -	- -	-
Sampath S, 2013_2	Unknown	TaqMan and Sequenom	2051	- (-)			-	- -	- -
Jonsson L, 2014_1	Sweden	the Kompetitive Allele Specific PCR (KASP) Genotyping System	6171	12319 (-)			autistic-like trait	- -	- -

Case Control Based Association Studies: 4

Reference	Source	Platfrom	ASD Cases					Normal Controls		Result
Reference	Source	Platfrom	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)	Result
CAUCASIAN
Koberstein JN, 2018_1	Unknown	Life Technologies	-	-	ASD	- 3.3 to 15.2 years	-	214 (-)	- 3.2 to 16.3 years	-
MIXED/OTHERS
Poot M, 2014_1	Unknown	Illumina Infinium HumanHap300 Genotyping BeadChip SNP arrays			ASD	- -	-	117 (-)	- 20-49?
Nascimento PP, 2016_1	Brazilian	PCR-RFLP			ASD	13.4 -	-	200 (31.50%)	34 -
Nascimento PP, 2016_1	Brazilian	PCR-RFLP			ASD	13.4 -	-	200 (31.50%)	34 -
Werling AM, 2016_1	Unknown	TaqMan SNP Genotyping			HFA	11.32 from 5 to 18 years	-	133 (18.80%)	11.51 from 6 to 17 years

Large Scale Expression Studies Top

Reference	Source	Tissue	#Subjects (% Women)	ADI-R	ADOS	Endo- pheno	Diagnosis	Normal Controls (% Women)	Fold Change	Up/ Down	P/Q value
No Evidence.

Reference	Source	Tissue	Platform	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Normal Controls(% Women)
No Evidence.

NGS de novo Mutation Studies Top

Reference	Case Number	Family Number	de novo Number	Title
No matched NGS de novo Mutation Studies!

NGS Mosaic SNV Studies Top

Reference	Case Number	Family Number	Mosaic Number	Title
No matched NGS Mosaic SNVs!

NGS Other Studies Top

Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Family			Affected	Validation Method
Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Affected	Validation Method
Alvarez-Mora MI, 2016	-	Illumina MiSeq			ASD	-	-	-	44	Sanger sequencing
Doan RN, 2016	-	-	-	-	ASD	-	-	-	-	-
Wen Z, 2017	China	Illumina HiSeq 2500			ASD	-	-	-	120	Sanger sequencing
Kalsner L, 2018	-	-			ASD	-	-	-	100	-

Low Scale Gene Studies Top

Reference	Organism	Tissue	ADI-R	ADOS	Diagnosis	Evidence Level	Result
No Evidence.

Contact Us if you are an author of a study regarding this gene and do not find your study in this table or find errors in the representation of your study details.

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics

Studies: 1,036
Genes: 1,379
CNVs/SVs: 5,420
SNVs/Indels: 11,669
de novo Mutations: 5,669
Mosaics: 789
Linkage Regions: 172

Paper Collected: 6/30/2018

Last Update: 8/26/2018

AutismKB 2.0

Evidence Details for CNTNAP2

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics