Evidence Details for FOXP1

View Evidences	View Variants	View Annotations

Basic Information Top

Gene Symbol:	FOXP1 ( 12CC4,FLJ23741,MGC12942,MGC88572,MGC99551,QRF1,hFKH1B )
Gene Full Name:	forkhead box P1
Band:	3p13
Quick Links	Entrez ID:27086; OMIM: 605515; Uniprot ID:FOXP1_HUMAN; ENSEMBL ID: ENSG00000114861; HGNC ID: 3823
Relate to Another Database:	SFARIGene; denovo-db

Sequences Top

Nucleotide Sequence
Protein Sequence

>FOXP1|27086|nucleotide
ATGATGCAAGAATCTGGGACTGAGACAAAAAGTAACGGTTCAGCCATCCAGAATGGGTCGGGCGGCAGCAACCACTTACTAGAGTGCGGCGGTCTTCGGGAGGGG
CGGTCCAACGGAGAGACGCCGGCCGTGGACATCGGGGCAGCTGACCTCGCCCACGCCCAGCAGCAGCAGCAACAGTGGCATCTCATAAACCATCAGCCCTCTAGG
AGTCCCAGCAGTTGGCTTAAGAGACTAATTTCAAGCCCTTGGGAGTTGGAAGTCCTGCAGGTCCCCTTGTGGGGAGCAGTTGCTGAGACGAAGATGAGTGGACCT
GTGTGTCAGCCTAACCCTTCCCCATTTTGA

Show »

Evidence summary Top

Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default.

Evidences	Syndromic Gene	GWAS	CNV	Linkage	Association	Expression	NGS de novo	NGS Mosaic	NGS Other	Low-Scale Gene Studies	Total
Score (No. of Studies)	Yes	1 (1)	0 (2)	0 (0)	0 (0)	0 (0)	0 (4)	0 (0)	1 (2)	3 (3)	42 (12)

Syndromic Autism Gene Top

Abbreviations: AD, autosomal dominant; AR, autosomal recessive; ASD, autism spectrum disorder; ID, intellectual disability; XL, X linked.

Inheritance	AD
OMIM	Mental retardation with language impairment and autistic features (613670)
Description	Autosomal dominant non-syndromic ID and ASD; disrupted in two patients with ID and autism/ASD
Reference(s)	20950788;
Level	Level 3: The gene has been reported in more than one family with ASD/autistic features, but the disorder hasn't been a generally acknowledged ASD related disorder.

Genome-Wide Association Studies (By Ethnic Group) Top

Family Based Association Studies: 0

Reference	Stage	Platform	#Families	Affecteds						Result
Reference	Stage	Platform	#Families	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)	Result
No Evidence.

Case Control Based Association Studies: 1

Reference	Stage	Platform	ASD Cases						Normal Controls		Result
Reference	Stage	Platform	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)	Result
MIXED/OTHERS
Anney RJL, 2017_3	replication		1369 (-)			ASD	- -	-	137308 (-)	- -

CNV Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
Levy, 2011	Simons Simplex Collection	aCGH	-	-	ASD	915	915	-	-	-	-	-
Sanders, 2011	Simons Simplex Collection	SNP microarray	-	-	ASD	1127	1127	-	-	-	-	-

Linkage Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family	Individual
Total	Simplex	Multiplex	Control	Affected	Control	Total
No Matched Linkage Regions !

Low Scale Association Studies (by Ethnic Group) Top

Reference	Source	Platform	#Families	Affecteds	Result
#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)
No Evidence.

Reference	Source	Platfrom	ASD Cases	Normal Controls	Result
ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)
No Evidence.

Large Scale Expression Studies Top

Reference	Source	Tissue	#Subjects (% Women)	ADI-R	ADOS	Endo- pheno	Diagnosis	Normal Controls (% Women)	Fold Change	Up/ Down	P/Q value
No Evidence.

Reference	Source	Tissue	Platform	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Normal Controls(% Women)
No Evidence.

NGS de novo Mutation Studies Top

Reference	Case Number	Family Number	de novo Number	Title
O'Roak BJ, 2011	-	20	21	Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations.
Stessman HA, 2017	6342	-	74	Targeted sequencing identifies 91 neurodevelopmental-disorder risk genes with autism and development
Michaelson JJ, 2012	-	10	565	Whole-genome sequencing in autism identifies hot spots for de novo germline mutation.
Chen R, 2017	107	116	128	Leveraging blood serotonin as an endophenotype to identify de novo and rare variants involved in aut

NGS Mosaic SNV Studies Top

Reference	Case Number	Family Number	Mosaic Number	Title
No matched NGS Mosaic SNVs!

NGS Other Studies Top

Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Family			Affected	Validation Method
Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Affected	Validation Method
Brett M, 2014	-	Illumina HiSeq2000	-	-	autism	-	-	-	8	Sanger sequencing
Doan RN, 2016	-	-	-	-	ASD	-	-	-	-	-

Low Scale Gene Studies Top

Reference	Organism	Tissue	ADI-R	ADOS	Diagnosis	Evidence Level	Result
No Evidence.

Contact Us if you are an author of a study regarding this gene and do not find your study in this table or find errors in the representation of your study details.

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics

Studies: 1,036
Genes: 1,379
CNVs/SVs: 5,420
SNVs/Indels: 11,669
de novo Mutations: 5,669
Mosaics: 789
Linkage Regions: 172

Paper Collected: 6/30/2018

Last Update: 8/26/2018

AutismKB 2.0

Evidence Details for FOXP1

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics