Evidence Details for MECP2

View Evidences	View Variants	View Annotations

Basic Information Top

Gene Symbol:	MECP2 ( AUTSX3,DKFZp686A24160,MRX16,MRX79,MRXS13,MRXSL,PPMX,RS,RTS,RTT )
Gene Full Name:	methyl CpG binding protein 2 (Rett syndrome)
Band:	Xq28
Quick Links	Entrez ID:4204; OMIM: 300005; Uniprot ID:MECP2_HUMAN; ENSEMBL ID: ENSG00000169057; HGNC ID: 6990
Relate to Another Database:	SFARIGene; denovo-db

Sequences Top

Nucleotide Sequence
Protein Sequence

>MECP2|4204|nucleotide
ATGGCCGCCGCCGCCGCCGCCGCGCCGAGCGGAGGAGGAGGAGGAGGCGAGGAGGAGAGACTGGAAGAAAAGTCAGAAGACCAGGACCTCCAGGGCCTCAAGGAC
AAACCCCTCAAGTTTAAAAAGGTGAAGAAAGATAAGAAAGAAGAGAAAGAGGGCAAGCATGAGCCCGTGCAGCCATCAGCCCACCACTCTGCTGAGCCCGCAGAG
GCAGGCAAAGCAGAGACATCAGAAGGGTCAGGCTCCGCCCCGGCTGTGCCGGAAGCTTCTGCCTCCCCCAAACAGCGGCGCTCCATCATCCGTGACCGGGGACCC
ATGTATGATGACCCCACCCTGCCTGAAGGCTGGACACGGAAGCTTAAGCAAAGGAAATCTGGCCGCTCTGCTGGGAAGTATGATGTGTATTTGATCAATCCCCAG
GGAAAAGCCTTTCGCTCTAAAGTGGAGTTGATTGCGTACTTCGAAAAGGTAGGCGACACATCCCTGGACCCTAATGATTTTGACTTCACGGTAACTGGGAGAGGG
AGCCCCTCCCGGCGAGAGCAGAAACCACCTAAGAAGCCCAAATCTCCCAAAGCTCCAGGAACTGGCAGAGGCCGGGGACGCCCCAAAGGGAGCGGCACCACGAGA
CCCAAGGCGGCCACGTCAGAGGGTGTGCAGGTGAAAAGGGTCCTGGAGAAAAGTCCTGGGAAGCTCCTTGTCAAGATGCCTTTTCAAACTTCGCCAGGGGGCAAG
GCTGAGGGGGGTGGGGCCACCACATCCACCCAGGTCATGGTGATCAAACGCCCCGGCAGGAAGCGAAAAGCTGAGGCCGACCCTCAGGCCATTCCCAAGAAACGG
GGCCGAAAGCCGGGGAGTGTGGTGGCAGCCGCTGCCGCCGAGGCCAAAAAGAAAGCCGTGAAGGAGTCTTCTATCCGATCTGTGCAGGAGACCGTACTCCCCATC
AAGAAGCGCAAGACCCGGGAGACGGTCAGCATCGAGGTCAAGGAAGTGGTGAAGCCCCTGCTGGTGTCCACCCTCGGTGAGAAGAGCGGGAAAGGACTGAAGACC
TGTAAGAGCCCTGGGCGGAAAAGCAAGGAGAGCAGCCCCAAGGGGCGCAGCAGCAGCGCCTCCTCACCCCCCAAGAAGGAGCACCACCACCATCACCACCACTCA
Show »

Evidence summary Top

Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default.

Evidences	Syndromic Gene	GWAS	CNV	Linkage	Association	Expression	NGS de novo	NGS Mosaic	NGS Other	Low-Scale Gene Studies	Total
Score (No. of Studies)	Yes	0 (0)	1 (2)	0 (0)	1 (1)	0 (0)	1 (5)	0 (1)	2 (4)	1 (3)	40 (16)

Syndromic Autism Gene Top

Abbreviations: AD, autosomal dominant; AR, autosomal recessive; ASD, autism spectrum disorder; ID, intellectual disability; XL, X linked.

Inheritance	XL
OMIM	Rett syndrome (312750)
Description	MECP2 mutations or deletions cause Rett syndrome in females, and congenital encephalopathy or non-syndromic ID in males; MECP2 duplication syndrome, mostly in males
Reference(s)	16418599; 12770674; 17286265; 12959422; 16980810; 12707946;
Level	Level 4: The disorder is a generally acknowledged ASD related disorder.

Genome-Wide Association Studies(By Ethnic Group) Top

Reference	Stage	Platform	#Families	Affecteds	Result
#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)
No Evidence.

Reference	Stage	Platform	ASD Cases	Normal Controls	Result
#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)
No Evidence.

CNV Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
Bremer, 2011	-	aCGH			ASD	-	-	-	-	223	-	223
Woodbury-Smith M, 2017	-	Microarray			ASD	-	-	-	-	1	-	-

Linkage Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family	Individual
Total	Simplex	Multiplex	Control	Affected	Control	Total
No Matched Linkage Regions !

Low Scale Association Studies (by Ethnic Group) Top

Family Based Association Studies: 1

Reference	Source	Platform	#Families	Affecteds						Result
Reference	Source	Platform	#Families	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)	Result
CAUCASIAN
Loat, 2008_1	England, USA	ABI prism 3100 Genetic Analyzer	219	219 (-)			ASD	- -	>35 -

Case Control Based Association Studies: 0

Reference	Source	Platfrom	ASD Cases					Normal Controls		Result
Reference	Source	Platfrom	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)	Result
No Evidence.

Large Scale Expression Studies Top

Reference	Source	Tissue	#Subjects (% Women)	ADI-R	ADOS	Endo- pheno	Diagnosis	Normal Controls (% Women)	Fold Change	Up/ Down	P/Q value
No Evidence.

Reference	Source	Tissue	Platform	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Normal Controls(% Women)
No Evidence.

NGS de novo Mutation Studies Top

Reference	Case Number	Family Number	de novo Number	Title
Wang T, 2016	1543	1045	54	De novo genic mutations among a Chinese autism spectrum disorder cohort
C Yuen RK, 2017	1625	-	237	Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder.
Li J, 2017	536	-	22	Targeted sequencing and functional analysis reveal brain-size-related genes and their networks in au
Wen Z, 2017	120	-	2	Identification of autism-related MECP2 mutations by whole-exome sequencing and functional validation
Bowling KM, 2017	18	-	18	Genomic diagnosis for children with intellectual disability and/or developmental delay.

NGS Mosaic SNV Studies Top

Reference	Case Number	Family Number	Mosaic Number	Title
Curie A, 2017	1	0	1	Asperger syndrome and early-onset schizophrenia associated with a novel MECP2 deleterious missense v

NGS Other Studies Top

Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Family			Affected	Validation Method
Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Affected	Validation Method
McCarthy SE, 2014	-	Illumina HiSeq2000			autism	-	-	-	-	-
Wang T, 2016	China	Illumina HiSeq 2000			ASD	1045	-	-	1543	PCR and Sanger sequencing
Alvarez-Mora MI, 2016	-	Illumina MiSeq			ASD	-	-	-	44	Sanger sequencing
Wen Z, 2017	China	Illumina HiSeq 2500			ASD	-	-	-	120	Sanger sequencing

Low Scale Gene Studies Top

Reference	Organism	Tissue	ADI-R	ADOS	Diagnosis	Evidence Level	Result
No Evidence.

Contact Us if you are an author of a study regarding this gene and do not find your study in this table or find errors in the representation of your study details.

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics

Studies: 1,036
Genes: 1,379
CNVs/SVs: 5,420
SNVs/Indels: 11,669
de novo Mutations: 5,669
Mosaics: 789
Linkage Regions: 172

Paper Collected: 6/30/2018

Last Update: 8/26/2018

AutismKB 2.0

Evidence Details for MECP2

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics