Evidence Details for OXTR

View Evidences	View Variants	View Annotations

Basic Information Top

Gene Symbol:	OXTR ( OT-R )
Gene Full Name:	oxytocin receptor
Band:	3p25.3
Quick Links	Entrez ID:5021; OMIM: 167055; Uniprot ID:OXYR_HUMAN; ENSEMBL ID: ENSG00000180914; HGNC ID: 8529
Relate to Another Database:	SFARIGene; denovo-db

Sequences Top

Nucleotide Sequence
Protein Sequence

>OXTR|5021|nucleotide
ATGGAGGGCGCGCTCGCAGCCAACTGGAGCGCCGAGGCAGCCAACGCCAGCGCCGCGCCGCCGGGGGCCGAGGGCAACCGCACCGCCGGACCCCCGCGGCGCAAC
GAGGCCCTGGCGCGCGTGGAGGTGGCGGTGCTGTGTCTCATCCTGCTCCTGGCGCTGAGCGGGAACGCGTGTGTGCTGCTGGCGCTGCGCACCACACGCCAGAAG
CACTCGCGCCTCTTCTTCTTCATGAAGCACCTAAGCATCGCCGACCTGGTGGTGGCAGTGTTTCAGGTGCTGCCGCAGTTGCTGTGGGACATCACCTTCCGCTTC
TACGGGCCCGACCTGCTGTGCCGCCTGGTCAAGTACTTGCAGGTGGTGGGCATGTTCGCCTCCACCTACCTGCTGCTGCTCATGTCCCTGGACCGCTGCCTGGCC
ATCTGCCAGCCGCTGCGCTCGCTGCGCCGCCGCACCGACCGCCTGGCAGTGCTCGCCACGTGGCTCGGCTGCCTGGTGGCCAGCGCGCCGCAGGTGCACATCTTC
TCTCTGCGCGAGGTGGCTGACGGCGTCTTCGACTGCTGGGCCGTCTTCATCCAGCCCTGGGGACCCAAGGCCTACATCACATGGATCACGCTAGCTGTCTACATC
GTGCCGGTCATCGTGCTCGCTGCCTGCTACGGCCTTATCAGCTTCAAGATCTGGCAGAACTTGCGGCTCAAGACCGCTGCAGCGGCGGCGGCCGAGGCGCCAGAG
GGCGCGGCGGCTGGCGATGGGGGGCGCGTGGCCCTGGCGCGTGTCAGCAGCGTCAAGCTCATCTCCAAGGCCAAGATCCGCACGGTCAAGATGACTTTCATCATC
GTGCTGGCCTTCATCGTGTGCTGGACGCCTTTCTTCTTCGTGCAGATGTGGAGCGTCTGGGATGCCAACGCGCCCAAGGAAGCCTCGGCCTTCATCATCGTCATG
CTCCTGGCCAGCCTCAACAGCTGCTGCAACCCCTGGATCTACATGCTGTTCACGGGCCACCTCTTCCACGAACTCGTGCAGCGCTTCCTGTGCTGCTCCGCCAGC
TACCTGAAGGGCAGACGCCTGGGAGAGACGAGTGCCAGCAAAAAGAGCAACTCGTCCTCCTTTGTCCTGAGCCATCGCAGCTCCAGCCAGAGGAGCTGCTCCCAG
Show »

Evidence summary Top

Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default.

Evidences	Syndromic Gene	GWAS	CNV	Linkage	Association	Expression	NGS de novo	NGS Mosaic	NGS Other	Low-Scale Gene Studies	Total
Score (No. of Studies)	No	1 (2)	0 (2)	1 (3)	3 (10)	1 (1)	0 (0)	0 (0)	0 (0)	2 (3)	33 (21)

Syndromic Autism Gene Top

Genome-Wide Association Studies (By Ethnic Group) Top

Family Based Association Studies: 0

Reference	Stage	Platform	#Families	Affecteds						Result
Reference	Stage	Platform	#Families	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)	Result
No Evidence.

Case Control Based Association Studies: 2

Reference	Stage	Platform	ASD Cases						Normal Controls		Result
Reference	Stage	Platform	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)	Result
CAUCASIAN
de Krom, 2008_2	Replication	Illumina 96 Golden Gate bead array	128 (14.06%)			ASD	- (4-18)	-	273 (-)	- -
de Krom, 2008_1	Discovery	the 1536 Golden Gate bead array of Illumina (Illumina, San Diego, California).	144 (17.36%)			ASD	- (4-18)	-	404 (-)	- -

CNV Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
Gregory, 2009	USA	aCGH			ASD	-	-	-	-	119	54	173
Bremer, 2011	-	aCGH			ASD	-	-	-	-	223	-	223

Linkage Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
McCauley, 2005	-	microsatellite-based genomic screen			autism	158	-	158	-	333	-	-
Shao, 2002	USA	microsatellite-based genomic screen			autism	52	-	52	-	112	-	-
Lauritsen, 2006	Faroe Islands	microsatellite-based genomic screen			autism	-	-	-	-	12	44	56

Low Scale Association Studies (by Ethnic Group) Top

Family Based Association Studies: 8

Reference	Source	Platform	#Families	Affecteds						Result
Reference	Source	Platform	#Families	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)	Result
CAUCASIAN
Jacob, 2007_1	USA	TaqMan SNP Genotyping Assays	57	57 (21.05%)			AD	6.4±3.5 -	- -
Yrigollen, 2008_1	USA	TaqMan SNP Genotyping Assays, ABI Prism 7900HT	151	177 (12.99%)			ASD	10.97 -	96.65 -
Wermter, 2009_1	Germany	Tetra-primer ARMS-PCR,PCR-RFLP	100	100 (5.00%)			ASD	12.2±4.7 (6-24)	100.2±19.4 -
Tansey, 2010_1	Ireland, Portugal, UK	ABI 7900HT sequence detection system	436	436 (-)			ASD	- -	- -
ASIAN
Wu, 2005_1	China	PCR-RFLP	195	195 (10.77%)			ASD	6.7±2.9 -	- -
Lerer, 2008_1	Israel	SNaPshot Method,ABI PRISM 310 automated sequencer	133	152 (15.79%)			ASD	- (2.08-33.67)	68.7 -
Liu, 2010_1	Japan	TaqMan genotyping platform	217	223 (15.25%)			ASD	18.35±9.5 -	- -
MIXED/OTHERS
Saito Y, 2014_1	Japanese	TaqMan	-	135 (-)			autistic-like traits	- -	- -	-
Harrison AJ, 2015_1	Unknown	PLINK;Haploview	2616	- (-)			ASD	- -	- -

Case Control Based Association Studies: 2

Reference	Source	Platfrom	ASD Cases					Normal Controls		Result
Reference	Source	Platfrom	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)	Result
CAUCASIAN
Kelemenova, 2010_1	Slovakia	-			ASD	- -	-	85 (-)	- -
Nyffeler J, 2014_1	Switzerland	TaqMan SNP Genotyping Assays			high functioning autism	11.24 5-17 years	-	99 (22.22%)	- -	-
ASIAN
Liu, 2010_1	Japan	-			ASD	18.35±9.5 (223), 25.20±4.8 (65) -	-	440 (38.18%)	40.9±9.7 -
MIXED/OTHERS
Egawa J, 2015_1	Japanese	TaqMan			autistic disorder	17.2 -	-	667 (48.88%)	38.3 -	-

Large Scale Expression Studies Top

Microarray Studies: 1

Reference	Source	Tissue	#Subjects (% Women)	ADI-R	ADOS	Endo- pheno	Diagnosis	Normal Controls (% Women)	Fold Change	Up/ Down	P/Q value
Ghahramani Seno, 2010_1	Unknown	lymphoblastoid cell-line	20 (35.00%)			-	AD	22 (13.64%)	1.36	Up	0.0652
Platform: Illumina HumanRef-8_V3 gene expression arrays (San Diego, USA) ProbeSet: ILMN_1804929 RefSeq_ID/ EST: - GEO_ID: - Statistic Method: Generalized Estimating Equations (GEE)

Proteomics Studies:0

Reference	Source	Tissue	Platform	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Normal Controls(% Women)
No Evidence.

NGS de novo Mutation Studies Top

Reference	Case Number	Family Number	de novo Number	Title
No matched NGS de novo Mutation Studies!

NGS Mosaic SNV Studies Top

Reference	Case Number	Family Number	Mosaic Number	Title
No matched NGS Mosaic SNVs!

NGS Other Studies Top

Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Family			Affected	Validation Method
Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Affected	Validation Method
No matched NGS Other Studies!

Low Scale Gene Studies Top

Reference	Organism	Tissue	ADI-R	ADOS	Diagnosis	Evidence Level	Result
No Evidence.

Contact Us if you are an author of a study regarding this gene and do not find your study in this table or find errors in the representation of your study details.

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics

Studies: 1,036
Genes: 1,379
CNVs/SVs: 5,420
SNVs/Indels: 11,669
de novo Mutations: 5,669
Mosaics: 789
Linkage Regions: 172

Paper Collected: 6/30/2018

Last Update: 8/26/2018

AutismKB 2.0

Evidence Details for OXTR

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics