Evidence Details for RBFOX1

View Evidences	View Variants	View Annotations

Basic Information Top

Gene Symbol:	RBFOX1 ( A2BP1,FOX-1,FOX1,HRNBP1 )
Gene Full Name:	RNA binding protein, fox-1 homolog (C. elegans) 1
Band:	16p13.3
Quick Links	Entrez ID:54715; OMIM: 605104; Uniprot ID:RFOX1_HUMAN; ENSEMBL ID: ENSG00000078328; HGNC ID: 18222
Relate to Another Database:	SFARIGene; denovo-db

Sequences Top

Nucleotide Sequence
Protein Sequence

>RBFOX1|54715|nucleotide
ATGAATTGTGAAAGAGAGCAGCTAAGGGGTAATCAGGAAGCAGCCGCTGCCCCTGACACAATGGCTCAGCCTTACGCTTCGGCCCAGTTTGCTCCCCCGCAGAAC
GGTATCCCCGCGGAATACACGGCCCCTCATCCCCACCCCGCGCCAGAGTACACAGGCCAGACCACGGTTCCCGAGCACACATTAAACCTGTACCCTCCCGCCCAG
ACGCACTCCGAGCAGAGCCCGGCGGACACGAGCGCTCAGACCGTCTCTGGCACCGCCACACAGACAGATGACGCAGCACCGACGGATGGCCAGCCCCAGACACAA
CCTTCTGAAAACACGGAAAACAAGTCTCAGCCCAAGCGGCTGCATGTCTCCAATATCCCCTTCAGGTTCCGGGATCCGGACCTCAGACAAATGTTTGGTCAATTT
GGTAAAATCTTAGATGTTGAAATTATTTTTAATGAGCGAGGCTCAAAGGGATTTGGTTTCGTAACTTTCGAAAATAGTGCCGATGCGGACAGGGCGAGGGAGAAA
TTACACGGCACCGTGGTAGAGGGCCGTAAAATCGAGGTAAATAATGCCACAGCACGTGTAATGACAAATAAAAAGACCGTCAACCCTTATACAAATGGCTGGAAA
TTGAATCCAGTTGTGGGTGCAGTCTACAGTCCCGAATTCTATGCAGTGCCAGGCTTCCCGTATCCAGCAGCCACCGCCGCGGCCGCCTACCGAGGGGCGCACCTG
CGAGGCCGCGGTCGCACCGTGTACAACACCTTCAGGGCCGCGGCGCCCCCGCCCCCGATCCCGGCCTACGGCGGTGTTGTTTACCAGGATGGATTTTATGGTGCA
GACATTTATGGTGGTTATGCTGCATACCGCTACGCCCAGCCTACCCCTGCCACTGCCGCTGCCTACAGTGACAGTTACGGACGAGTTTATGCTGCCGACCCCTAC
CACCACGCACTTGCTCCAGCCCCCACCTACGGCGTTGGTGCCATGAATGCTTTTGCACCTTTGACTGATGCCAAGACTAGGAGCCATGCTGATGATGTGGGTCTC
GTTCTTTCTTCATTGCAGGCTAGTATATACCGAGGGGGATACAACCGTTTTGCTCCATACTAA
Show »

Evidence summary Top

Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default.

Evidences	Syndromic Gene	GWAS	CNV	Linkage	Association	Expression	NGS de novo	NGS Mosaic	NGS Other	Low-Scale Gene Studies	Total
Score (No. of Studies)	No	0 (0)	1 (6)	2 (5)	0 (2)	2 (2)	0 (1)	0 (0)	0 (1)	2 (2)	28 (19)

Syndromic Autism Gene Top

Genome-Wide Association Studies(By Ethnic Group) Top

Reference	Stage	Platform	#Families	Affecteds	Result
#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)
No Evidence.

Reference	Stage	Platform	ASD Cases	Normal Controls	Result
#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)
No Evidence.

CNV Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
Szatmari, 2007	Europe, North America	SNP microarray			ASD	1491	-	-	-	-	-	0
Sebat, 2007	USA	aCGH			autism	165	118	47	99	195	196	391
Pinto, 2010	-	SNP microarray, qPCR			ASD	-	-	-	-	996	1287	2283
Gai, 2011	AGRE	SNP microarray	-	-	autism	-	-	-	-	1224	3801	5025
Sanders, 2011	Simons Simplex Collection	SNP microarray	-	-	ASD	1127	1127	-	-	-	-	-
Kanduri C, 2016	Finnish	-			autism	83	-	-	-	257	288	545

Linkage Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
McCauley, 2005	-	microsatellite-based genomic screen			autism	158	-	158	-	333	-	-
Bailey, 1998	-	microsatellite-based genomic screen			PDD	99	-	99	-	-	-	-
Monaco, 2001	-	microsatellite-based genomic screen			PDD	152	-	152	-	-	-	-
Buxbaum, 2004	USA	microsatellite-based genomic screen			autism	115	-	115	-	-	-	-
Lauritsen, 2006	Faroe Islands	microsatellite-based genomic screen			autism	-	-	-	-	12	44	56

Low Scale Association Studies (by Ethnic Group) Top

Family Based Association Studies: 1

Reference	Source	Platform	#Families	Affecteds						Result
Reference	Source	Platform	#Families	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)	Result
CAUCASIAN
Martin, 2007_1	AGRE	-	206	- (-)			ASD	- -	- -

Case Control Based Association Studies: 1

Reference	Source	Platfrom	ASD Cases					Normal Controls		Result
Reference	Source	Platfrom	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)	Result
CAUCASIAN
Lucarelli, 2003_1	Italy	-			ASD	- (3-13)	-	119 (42.86%)	- (3-13)

Large Scale Expression Studies Top

Microarray Studies: 2

Reference	Source	Tissue	#Subjects (% Women)	Endo- pheno	Diagnosis	Normal Controls (% Women)	Fold Change	Up/ Down	P/Q value
Voineagu, 2011_1	Unknown	16 frontal cortex(BA9) and 13 temporal cortex(BA41	16 (25.00%)	-	autism	16 (6.25%)	0.74821	Down	-
Platform: Illumina Ref8 v3 microarrays ProbeSet: ILMN_1731507 RefSeq_ID/ EST: - GEO_ID: GSE28521 Statistic Method: SAM package and unless otherwise specified the significance threshold was FDR,0.05 and fold changes.1.3.
Voineagu, 2011_1	Unknown	16 frontal cortex(BA9) and 13 temporal cortex(BA41	16 (25.00%)	-	autism	16 (6.25%)	0.739897	Down	-
Platform: Illumina Ref8 v3 microarrays ProbeSet: ILMN_1814316 RefSeq_ID/ EST: - GEO_ID: GSE28521 Statistic Method: SAM package and unless otherwise specified the significance threshold was FDR,0.05 and fold changes.1.3.
Voineagu, 2011_1	Unknown	16 frontal cortex(BA9) and 13 temporal cortex(BA41	16 (25.00%)	-	autism	16 (6.25%)	0.731078	Down	-
Platform: Illumina Ref8 v3 microarrays ProbeSet: ILMN_2359168 RefSeq_ID/ EST: - GEO_ID: GSE28521 Statistic Method: SAM package and unless otherwise specified the significance threshold was FDR,0.05 and fold changes.1.3.
Voineagu, 2011_2	Unknown	frontal, BA44/45	10 (0.00%)	-	autism	6 (0.00%)	0.694897	Down	0.0333647
Platform: Illumina Ref8 v4 microarrays ProbeSet: ILMN_1731507 RefSeq_ID/ EST: - GEO_ID: GSE28521 Statistic Method: SAM package and unless otherwise specified the significance threshold was FDR,0.05 and fold changes.1.3.
Voineagu, 2011_2	Unknown	frontal, BA44/45	10 (0.00%)	-	autism	6 (0.00%)	0.695145	Down	0.0158402
Platform: Illumina Ref8 v4 microarrays ProbeSet: ILMN_1814316 RefSeq_ID/ EST: - GEO_ID: GSE28521 Statistic Method: SAM package and unless otherwise specified the significance threshold was FDR,0.05 and fold changes.1.3.
Voineagu, 2011_2	Unknown	frontal, BA44/45	10 (0.00%)	-	autism	6 (0.00%)	0.714607	Down	0.0386687
Platform: Illumina Ref8 v4 microarrays ProbeSet: ILMN_2359168 RefSeq_ID/ EST: - GEO_ID: GSE28521 Statistic Method: SAM package and unless otherwise specified the significance threshold was FDR,0.05 and fold changes.1.3.

Proteomics Studies:0

Reference	Source	Tissue	Platform	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Normal Controls(% Women)
No Evidence.

NGS de novo Mutation Studies Top

Reference	Case Number	Family Number	de novo Number	Title
Turner TN, 2016	53	-	27	Genome Sequencing of Autism-Affected Families Reveals Disruption of Putative Noncoding Regulatory DN

NGS Mosaic SNV Studies Top

Reference	Case Number	Family Number	Mosaic Number	Title
No matched NGS Mosaic SNVs!

NGS Other Studies Top

Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Family			Affected	Validation Method
Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Affected	Validation Method
Doan RN, 2016	-	-	-	-	ASD	-	-	-	-	-

Low Scale Gene Studies Top

Reference	Organism	Tissue	ADI-R	ADOS	Diagnosis	Evidence Level	Result
No Evidence.

Contact Us if you are an author of a study regarding this gene and do not find your study in this table or find errors in the representation of your study details.

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics

Studies: 1,036
Genes: 1,379
CNVs/SVs: 5,420
SNVs/Indels: 11,669
de novo Mutations: 5,669
Mosaics: 789
Linkage Regions: 172

Paper Collected: 6/30/2018

Last Update: 8/26/2018

AutismKB 2.0

Evidence Details for RBFOX1

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics