Evidence Details for AHI1

View Evidences	View Variants	View Annotations

Basic Information Top

Gene Symbol:	AHI1 ( AHI-1,DKFZp686J1653,FLJ14023,FLJ20069,JBTS3,ORF1,dJ71N10.1 )
Gene Full Name:	Abelson helper integration site 1
Band:	6q23.3
Quick Links	Entrez ID:54806; OMIM: 608894; Uniprot ID:AHI1_HUMAN; ENSEMBL ID: ENSG00000135541; HGNC ID: 21575
Relate to Another Database:	SFARIGene; denovo-db

Sequences Top

Nucleotide Sequence
Protein Sequence

>AHI1|54806|nucleotide
ATGCCTACAGCTGAGAGTGAAGCAAAAGTAAAAACCAAAGTTCGCTTTGAAGAATTGCTTAAGACCCACAGTGATCTAATGCGTGAAAAGAAAAAACTGAAGAAA
AAACTTGTCAGGTCTGAAGAAAACATCTCACCTGACACTATTAGAAGCAATCTTCACTATATGAAAGAAACTACAAGTGATGATCCCGACACTATTAGAAGCAAT
CTTCCCCATATTAAAGAAACTACAAGTGATGATGTAAGTGCTGCTAACACTAACAACCTGAAGAAGAGCACGAGAGTCACTAAAAACAAATTGAGGAACACACAG
TTAGCAACTGAAAATCCTAATGGTGATGCTAGTGTAGAGGAAGACAAACAAGGAAAGCCAAATAAAAAGGTGATAAAGACGGTGCCCCAGTTGACTACACAAGAC
CTGAAACCGGAAACTCCTGAGAATAAGGTTGATTCTACACACCAGAAAACACATACAAAGCCACAGCCAGGCGTTGATCATCAGAAAAGTGAGAAGGCAAATGAG
GGAAGAGAAGAGACTGATTTAGAAGAGGATGAAGAATTGATGCAAGCATATCAGTGCCATGTAACTGAAGAAATGGCAAAGGAGATTAAGAGGAAAATAAGAAAG
AAACTGAAAGAACAGTTGACTTACTTTCCCTCAGATACTTTATTCCATGATGACAAACTAAGCAGTGAAAAAAGGAAAAAGAAAAAGGAAGTTCCAGTCTTCTCT
AAAGCTGAAACAAGTACATTGACCATCTCTGGTGACACAGTTGAAGGTGAACAAAAGAAAGAATCTTCAGTTAGATCAGTTTCTTCAGATTCTCATCAAGATGAT
GAAATAAGCTCAATGGAACAAAGCACAGAAGACAGCATGCAAGATGATACAAAACCTAAACCAAAAAAAACAAAAAAGAAGACTAAAGCAGTTGCAGATAATAAT
GAAGATGTTGATGGTGATGGTGTTCATGAAATAACAAGCCGAGATAGCCCGGTTTATCCCAAATGTTTGCTTGATGATGACCTTGTCTTGGGAGTTTACATTCAC
CGAACTGATAGACTTAAGTCAGATTTTATGATTTCTCACCCAATGGTAAAAATTCATGTGGTTGATGAGCATACTGGTCAATATGTCAAGAAAGATGATAGTGGA
Show »

Evidence summary Top

Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default.

Evidences	Syndromic Gene	GWAS	CNV	Linkage	Association	Expression	NGS de novo	NGS Mosaic	NGS Other	Low-Scale Gene Studies	Total
Score (No. of Studies)	Yes	0 (0)	0 (0)	1 (2)	1 (1)	3 (3)	1 (3)	0 (0)	1 (1)	0 (0)	25 (10)

Syndromic Autism Gene Top

Abbreviations: AD, autosomal dominant; AR, autosomal recessive; ASD, autism spectrum disorder; ID, intellectual disability; XL, X linked.

Inheritance	AR
OMIM	Leber congenital amaurosis 2 (204100)
Description	Joubert syndrome 3. Joubert syndrome is a clinically and genetically heterogeneous group of ciliopathies characterized by cerebellar ataxia, ID and breathing abnormalities, sometimes including retinal dystrophy and renal disease. ASD is a relatively frequent finding in patients with Joubert syndrome, present in 13-36% of patients. Ten genes have been implicated in Joubert syndrome, but so far, only 4 have been reported to be mutated in subjects with ASD/autistic traits
Reference(s)	10511335; 15633174; 2015333;
Level	Level 3: The gene has been reported in more than one family with ASD/autistic features, but the disorder hasn't been a generally acknowledged ASD related disorder.

Genome-Wide Association Studies(By Ethnic Group) Top

Reference	Stage	Platform	#Families	Affecteds	Result
#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)
No Evidence.

Reference	Stage	Platform	ASD Cases	Normal Controls	Result
#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)
No Evidence.

CNV Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
No matched CNVs !

Linkage Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
Lauritsen, 2006	Faroe Islands	microsatellite-based genomic screen			autism	-	-	-	-	12	44	56
Allen-Brady, 2010	USA	SNP-based genomic screen			ASD	40	-	40	-	192	461	653

Low Scale Association Studies (by Ethnic Group) Top

Family Based Association Studies: 1

Reference	Source	Platform	#Families	Affecteds						Result
Reference	Source	Platform	#Families	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)	Result
CAUCASIAN
Alvarez Retuerto, 2008_1	AGRE	BigDye Terminator v3.1 Cycle Sequencing Kit,3730xl DNA Analyzer (ABI),Phred, Phrap, Polyphred, Consed software suite	327	327 (-)			ASD	- -	- -

Case Control Based Association Studies: 0

Reference	Source	Platfrom	ASD Cases					Normal Controls		Result
Reference	Source	Platfrom	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)	Result
No Evidence.

Large Scale Expression Studies Top

Microarray Studies: 3

Reference	Source	Tissue	#Subjects (% Women)	ADI-R	ADOS	Endo- pheno	Diagnosis	Normal Controls (% Women)	Fold Change	Up/ Down	P/Q value
Garbett, 2008_1	Unknown	superior temporal gyrus (STG)	6 (33.33%)	-	-	-	autism	6 (33.33%)	3.68834	Up	0.0288342
Platform: Affymetrix Human Genome 133 plus 2 microarrays ProbeSet: 244699_at RefSeq_ID/ EST: - GEO_ID: - Statistic Method: pairwise/groupwise two-tailed t-test between the RMA intensities of AUT and CONT samples
Voineagu, 2011_1	Unknown	16 frontal cortex(BA9) and 13 temporal cortex(BA41	16 (25.00%)			-	autism	16 (6.25%)	0.777508	Down	-
Platform: Illumina Ref8 v3 microarrays ProbeSet: ILMN_1791006 RefSeq_ID/ EST: - GEO_ID: GSE28521 Statistic Method: SAM package and unless otherwise specified the significance threshold was FDR,0.05 and fold changes.1.3.
Voineagu, 2011_2	Unknown	frontal, BA44/45	10 (0.00%)			-	autism	6 (0.00%)	0.602094	Down	0.00211205
Platform: Illumina Ref8 v4 microarrays ProbeSet: ILMN_1791006 RefSeq_ID/ EST: - GEO_ID: GSE28521 Statistic Method: SAM package and unless otherwise specified the significance threshold was FDR,0.05 and fold changes.1.3.

Proteomics Studies:0

Reference	Source	Tissue	Platform	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Normal Controls(% Women)
No Evidence.

NGS de novo Mutation Studies Top

Reference	Case Number	Family Number	de novo Number	Title
Iossifov I, 2014	2508	-	1194	The contribution of de novo coding mutations to autism spectrum disorder.
Michaelson JJ, 2012	-	10	565	Whole-genome sequencing in autism identifies hot spots for de novo germline mutation.

NGS Mosaic SNV Studies Top

Reference	Case Number	Family Number	Mosaic Number	Title
No matched NGS Mosaic SNVs!

NGS Other Studies Top

Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Family			Affected	Validation Method
Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Affected	Validation Method
Brett M, 2014	-	Illumina HiSeq2000	-	-	autism	-	-	-	8	Sanger sequencing

Low Scale Gene Studies Top

Reference	Organism	Tissue	ADI-R	ADOS	Diagnosis	Evidence Level	Result
No Evidence.

Contact Us if you are an author of a study regarding this gene and do not find your study in this table or find errors in the representation of your study details.

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics

Studies: 1,036
Genes: 1,379
CNVs/SVs: 5,420
SNVs/Indels: 11,669
de novo Mutations: 5,669
Mosaics: 789
Linkage Regions: 172

Paper Collected: 6/30/2018

Last Update: 8/26/2018

AutismKB 2.0

Evidence Details for AHI1

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics