Evidence Details for PTEN

View Evidences	View Variants	View Annotations

Basic Information Top

Gene Symbol:	PTEN ( 10q23del,BZS,DEC,GLM2,MGC11227,MHAM,MMAC1,PTEN1,TEP1 )
Gene Full Name:	phosphatase and tensin homolog
Band:	10q23.31
Quick Links	Entrez ID:5728; OMIM: 601728; Uniprot ID:PTEN_HUMAN; ENSEMBL ID: ENSG00000171862; HGNC ID: 9588
Relate to Another Database:	SFARIGene; denovo-db

Sequences Top

Nucleotide Sequence
Protein Sequence

>PTEN|5728|nucleotide
ATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACAAAAGGAGATATCAAGAGGATGGATTCGACTTAGACTTGACCTATATTTATCCAAACATTATTGCTATG
GGATTTCCTGCAGAAAGACTTGAAGGCGTATACAGGAACAATATTGATGATGTAGTAAGGTTTTTGGATTCAAAGCATAAAAACCATTACAAGATATACAATCTT
TGTGCTGAAAGACATTATGACACCGCCAAATTTAATTGCAGAGTTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTTTGT
GAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTA
CATCGGGGCAAATTTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGGGAAGTAAGGACCAGAGACAAAAAGGGAGTAACTATTCCCAGTCAGAGGCGCTATGTG
TATTATTATAGCTACCTGTTAAAGAATCATCTGGATTATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTTGAAACTATTCCAATGTTCAGTGGCGGAACT
TGCAATCCTCAGTTTGTGGTCTGCCAGCTAAAGGTGAAGATATATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTCATGTACTTTGAGTTCCCTCAG
CCGTTACCTGTGTGTGGTGATATCAAAGTAGAGTTCTTCCACAAACAGAACAAGATGCTAAAAAAGGACAAAATGTTTCACTTTTGGGTAAATACATTCTTCATA
CCAGGACCAGAGGAAACCTCAGAAAAAGTAGAAAATGGAAGTCTATGTGATCAAGAAATCGATAGCATTTGCAGTATAGAGCGTGCAGATAATGACAAGGAATAT
CTAGTACTTACTTTAACAAAAAATGATCTTGACAAAGCAAATAAAGACAAAGCCAACCGATACTTTTCTCCAAATTTTAAGGTGAAGCTGTACTTCACAAAAACA
GTAGAGGAGCCGTCAAATCCAGAGGCTAGCAGTTCAACTTCTGTAACACCAGATGTTAGTGACAATGAACCTGATCATTATAGATATTCTGACACCACTGACTCT
Show »

Evidence summary Top

Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default.

Evidences	Syndromic Gene	GWAS	CNV	Linkage	Association	Expression	NGS de novo	NGS Mosaic	NGS Other	Low-Scale Gene Studies	Total
Score (No. of Studies)	Yes	0 (1)	0 (0)	1 (1)	0 (0)	0 (0)	3 (8)	0 (0)	2 (5)	3 (5)	78 (20)

Syndromic Autism Gene Top

Abbreviations: AD, autosomal dominant; AR, autosomal recessive; ASD, autism spectrum disorder; ID, intellectual disability; XL, X linked.

Inheritance	AD
OMIM	PTEN hamartoma-tumor syndrome (601728)
Description	PTEN hamartoma-tumor syndrome (including Bannayan-Riley-Ruvalcaba syndrome and Cowden syndrome); ID and ASD with macrocephaly. The frequency of PTEN mutations in children with ASD and macrocephaly is unknown; in one study, 15% (4/26) of children with PTEN mutations had ASD
Reference(s)	15805158; 17427195; 12920084; 11496368; 12567405; 19321504; 20533527; 18759867; 20814261; 17526801; 19265751;
Level	Level 3: The gene has been reported in more than one family with ASD/autistic features, but the disorder hasn't been a generally acknowledged ASD related disorder.

Genome-Wide Association Studies (By Ethnic Group) Top

Family Based Association Studies: 1

Reference	Stage	Platform	#Families	Affecteds						Result
Reference	Stage	Platform	#Families	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)	Result
CAUCASIAN
Hussman, 2011_1	Discovery	Illumina Infinium Human 1 M beadship	597	- (-)			ASD	- -	- -

Case Control Based Association Studies: 0

Reference	Stage	Platform	ASD Cases						Normal Controls		Result
Reference	Stage	Platform	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)	Result
No Evidence.

CNV Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
No matched CNVs !

Linkage Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
Buxbaum, 2004	USA	microsatellite-based genomic screen			autism	115	-	115	-	-	-	-

Low Scale Association Studies (by Ethnic Group) Top

Reference	Source	Platform	#Families	Affecteds	Result
#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)
No Evidence.

Reference	Source	Platfrom	ASD Cases	Normal Controls	Result
ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)
No Evidence.

Large Scale Expression Studies Top

Reference	Source	Tissue	#Subjects (% Women)	ADI-R	ADOS	Endo- pheno	Diagnosis	Normal Controls (% Women)	Fold Change	Up/ Down	P/Q value
No Evidence.

Reference	Source	Tissue	Platform	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Normal Controls(% Women)
No Evidence.

NGS de novo Mutation Studies Top

Reference	Case Number	Family Number	de novo Number	Title
O'Roak BJ, 2012	1703	209	242	Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations.
O'Roak BJ, 2012	2446	-	46	Multiplex targeted sequencing identifies recurrently mutated genes in autism spectrum disorders.
De Rubeis S, 2014	2270	-	1702	Synaptic, transcriptional and chromatin genes disrupted in autism
O'Roak BJ, 2014	3486	-	59	Recurrent de novo mutations implicate novel genes underlying simplex autism risk.
C Yuen RK, 2017	1625	-	237	Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder.
Saskin A, 2017	2392	2392	4	Prevalence of four Mendelian disorders associated with autism in 2392 affected families.

NGS Mosaic SNV Studies Top

Reference	Case Number	Family Number	Mosaic Number	Title
No matched NGS Mosaic SNVs!

NGS Other Studies Top

Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Family			Affected	Validation Method
Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Affected	Validation Method
O'Roak BJ, 2012	USA	Illumina HiSeq 2000	-	-	ASD	-	-	-	2446	-
Marchese M, 2014	-	-			ASD	-	-	-	81	-
Codina-Sol, 2015	Spanish	ABI Solid 4			ASD	-	-	-	36	Sequenom genotyping;Sanger sequencing
Iossifov I, 2015	-	-	-	-	-	-	-	-	-	-
Iossifov I, 2015	-	-	-	-	ASD	2471	-	-	-	-
Saskin A, 2017	-	-	-	-	ASD	2392	-	-	-	-

Low Scale Gene Studies Top

Reference	Organism	Tissue	ADI-R	ADOS	Diagnosis	Evidence Level	Result
No Evidence.

Contact Us if you are an author of a study regarding this gene and do not find your study in this table or find errors in the representation of your study details.

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics

Studies: 1,036
Genes: 1,379
CNVs/SVs: 5,420
SNVs/Indels: 11,669
de novo Mutations: 5,669
Mosaics: 789
Linkage Regions: 172

Paper Collected: 6/30/2018

Last Update: 8/26/2018

AutismKB 2.0

Evidence Details for PTEN

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics