Evidence Details for SPRR2D


Gene Symbol: | SPRR2D ( - ) |
---|---|
Gene Full Name: | small proline-rich protein 2D |
Band: | 1q21.3 |
Quick Links | Entrez ID:6703; OMIM: NA; Uniprot ID:SPR2D_HUMAN; ENSEMBL ID: ENSG00000163216; HGNC ID: 11264 |
Relate to Another Database: | SFARIGene; denovo-db |


>SPRR2D|6703|nucleotide
ATGTCTTATCAACAGCAGCAGTGCAAGCAGCCCTGCCAGCCACCTCCTGTGTGCCCCACGCCAAAGTGCCCAGAGCCATGTCCACCCCCGAAGTGCCCTGAGCCC
TGCCCATCACCAAAGTGTCCACAGCCCTGCCCACCTCAGCAGTGCCAGCAGAAATATCCTCCTGTGACACCTTCCCCACCCTGCCAGCCAAAGTGTCCACCCAAG
AGCAAGTAA
Show »
ATGTCTTATCAACAGCAGCAGTGCAAGCAGCCCTGCCAGCCACCTCCTGTGTGCCCCACGCCAAAGTGCCCAGAGCCATGTCCACCCCCGAAGTGCCCTGAGCCC
TGCCCATCACCAAAGTGTCCACAGCCCTGCCCACCTCAGCAGTGCCAGCAGAAATATCCTCCTGTGACACCTTCCCCACCCTGCCAGCCAAAGTGTCCACCCAAG
AGCAAGTAA
Show »


Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default.
Evidences | Syndromic Gene | GWAS | CNV | Linkage | Association | Expression | NGS de novo | NGS Mosaic | NGS Other | Low-Scale Gene Studies | Total |
---|---|---|---|---|---|---|---|---|---|---|---|
Score (No. of Studies) | No | 0 (0) | 1 (1) | 1 (1) | 0 (0) | 0 (0) | 0 (1) | 0 (0) | 0 (0) | 0 (0) | 4 (3) |






Reference | Source | Method | ADI-R | ADOS | Diagnosis | Family | Individual | |||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Total | Simplex | Multiplex | Control | Affected | Control | Total | ||||||
Zwaag, 2009 | - | SNP microarray | ![]() | ![]() | autism | - | - | - | - | 105 | 267 | 372 |


Reference | Source | Method | ADI-R | ADOS | Diagnosis | Family | Individual | |||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Total | Simplex | Multiplex | Control | Affected | Control | Total | ||||||
Auranen, 2002 | Finland | microsatellite-based genomic screen | ![]() | ![]() | autism | 19 | - | 19 | - | 54 | - | - |






Reference | Case Number | Family Number | de novo Number | Title |
---|---|---|---|---|
Neale BM, 2012 | 175 | 175 | 173 | Patterns and rates of exonic de novo mutations in autism spectrum disorders. |






Contact Us if you are an author of a study regarding this gene and do not find your study in this table or find errors in the representation of your study details.