Evidence Details for SNURF

View Evidences	View Variants	View Annotations

Basic Information Top

Gene Symbol:	SNURF ( - )
Gene Full Name:	SNRPN upstream reading frame
Band:	15q11.2
Quick Links	Entrez ID:8926; OMIM: NA; Uniprot ID:SNURF_HUMAN; ENSEMBL ID: ENSG00000128739,ENSG00000214265; HGNC ID: 11171
Relate to Another Database:	SFARIGene; denovo-db

Sequences Top

Nucleotide Sequence
Protein Sequence

>SNURF|8926|nucleotide
ATGGAGCGGGCAAGGGATCGCTTACACCTGAGACGAACTACAGAACAGCACGTACCAGAGGTGGAAGTCCAAGTCAAACGCAGAAGGACTGCCTCACTGAGCAAC
CAAGAGTGTCAGTTGTACCCGAGGCGTTCTCAGCAGCAGCAAGTACCTGTGGTGGATTTCCAGGCTGAACTGAGGCAGGCATTCTTAGCTGAGACACCAAGAGGT
GGTTAA

Show »

Evidence summary Top

Click the link of the category-specific score to view different category of evidences. The categories without any evidences are hidden by default.

Evidences	Syndromic Gene	GWAS	CNV	Linkage	Association	Expression	NGS de novo	NGS Mosaic	NGS Other	Low-Scale Gene Studies	Total
Score (No. of Studies)	No	0 (0)	2 (18)	0 (0)	0 (1)	0 (0)	0 (0)	0 (0)	0 (0)	0 (0)	4 (19)

Syndromic Autism Gene Top

Genome-Wide Association Studies(By Ethnic Group) Top

Reference	Stage	Platform	#Families	Affecteds	Result
#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)
No Evidence.

Reference	Stage	Platform	ASD Cases	Normal Controls	Result
#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)
No Evidence.

CNV Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family				Individual
Reference	Source	Method	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Control	Affected	Control	Total
Wolpert, 2000	-	STS mapping			autism	3	-	3	-	3	-	3
Wassink, 2001	USA	Chromosomal analysis of G-band			autism	-	-	-	-	278	-	278
Silva, 2002	-	FISH			autism	-	-	-	-	1	-	1
Keller, 2003	USA	FISH			ASD	-	-	-	-	2	-	2
Sahoo, 2005	USA	aCGH			autism	-	-	-	-	9	-	9
Jacquemont, 2006	France	aCGH			ASD	-	-	-	-	29	-	29
Sebat, 2007	USA	aCGH			autism	165	118	47	99	195	196	391
Wassink, 2007	USA	FISH			PDD	-	-	-	-	104	-	104
Szatmari, 2007	Europe, North America	SNP microarray			ASD	1491	-	-	-	-	-	0
Marshall, 2008	-	SNP microarray			ASD	427	238	189	-	427	500	927
Christian, 2008	USA	aCGH			ASD	397	35	362	-	397	372	769
Weiss, 2008	USA, Ireland	aCGH, SNP microarray			ASD	751	-	-	-	2252	23502	25754
Gregory, 2009	USA	aCGH			ASD	-	-	-	-	119	54	173
Bremer, 2009	-	aCGH			ASD	-	-	-	-	148	-	148
Bucan, 2009	USA	SNP microarray			autism, ASD	912	-	912	-	-	1488	1488
Pinto, 2010	-	SNP microarray, qPCR			ASD	-	-	-	-	996	1287	2283
Levy, 2011	Simons Simplex Collection	aCGH	-	-	ASD	915	915	-	-	-	-	-
Sanders, 2011	Simons Simplex Collection	SNP microarray	-	-	ASD	1127	1127	-	-	-	-	-

Linkage Studies Top

Reference	Source	Method	ADI-R	ADOS	Diagnosis	Family	Individual
Total	Simplex	Multiplex	Control	Affected	Control	Total
No Matched Linkage Regions !

Low Scale Association Studies (by Ethnic Group) Top

Family Based Association Studies: 0

Reference	Source	Platform	#Families	Affecteds						Result
Reference	Source	Platform	#Families	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Age (range)	IQ (range)	Result
No Evidence.

Case Control Based Association Studies: 1

Reference	Source	Platfrom	ASD Cases					Normal Controls		Result
Reference	Source	Platfrom	ADI-R	ADOS	Diagnosis	Age (range)	IQ	#Subjects (% Women)	Age (range)	Result
ASIAN
Kato, 2008_1	Japan	ABI PRISM 7900HT Sequence Detection System			ASD	19.9±9.8 -	-	416 (66.59%)	35.9±11.5 -

Large Scale Expression Studies Top

Reference	Source	Tissue	#Subjects (% Women)	ADI-R	ADOS	Endo- pheno	Diagnosis	Normal Controls (% Women)	Fold Change	Up/ Down	P/Q value
No Evidence.

Reference	Source	Tissue	Platform	#Subjects (% Women)	ADI-R	ADOS	Diagnosis	Normal Controls(% Women)
No Evidence.

NGS de novo Mutation Studies Top

Reference	Case Number	Family Number	de novo Number	Title
No matched NGS de novo Mutation Studies!

NGS Mosaic SNV Studies Top

Reference	Case Number	Family Number	Mosaic Number	Title
No matched NGS Mosaic SNVs!

NGS Other Studies Top

Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Family			Affected	Validation Method
Reference	Source	Platform	ADI-R	ADOS	Diagnosis	Total	Simplex	Multiplex	Affected	Validation Method
No matched NGS Other Studies!

Low Scale Gene Studies Top

Reference	Organism	Tissue	ADI-R	ADOS	Diagnosis	Evidence Level	Result
No Evidence.

Contact Us if you are an author of a study regarding this gene and do not find your study in this table or find errors in the representation of your study details.

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics

Studies: 1,036
Genes: 1,379
CNVs/SVs: 5,420
SNVs/Indels: 11,669
de novo Mutations: 5,669
Mosaics: 789
Linkage Regions: 172

Paper Collected: 6/30/2018

Last Update: 8/26/2018

AutismKB 2.0

Evidence Details for SNURF

Simple Query:

Syndromic Genes

Non-syndromic Genes

AutismKB Statistics